{[ promptMessage ]}

Bookmark it

{[ promptMessage ]}

212_Sample_exam - 16.. *becareful a.3 b.100 c.300 d.900...

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
Biology 212 Sample Exam Questions 16.  A particular eukaryotic protein is 300 amino acids long. Which of the following could  be the number of nucleotides in the gene  that codes for this protein?  (*be careful!*) a. 3 b. 100 c. 300 d. 900 e. 1800 explain your answer: Amino acids are 'coded' by three nucleotides thus, 3*300 = 900 plus the extra UTR portions etc that a GENE has. 17.  Imagine the following DNA sequence represents a  gene  that encodes a small peptide in a  prokaryotic  organism. Describe the  sequence of events that will take place to convert this genetic information into a poly peptide  (Both transcription and  translation!) .  Be as complete as possible and be sure to indicate the sequence of the mRNA and the sequence of the peptide that  are created (see the universal code on the last page of your test).  promoter region 5’ (ATGACGTATAA) TGACCGTACATGAGTAATACATAAATCAG 3’ 3’ (TACTGCATATT) ACTGGCATGTACTCATTATGTATTTAGTC 5’ *no introns etc 18. During a study session about evolution, one of your classmates remarks “ The giraffe stretched its neck while reaching for higher  leaves so its offspring inherited longer necks as a result.” What would you say to correct your fellow student’s misconception? As genes are units of heredity passed on to subsequent generations, then the offspring generally inherits the genetics from the  parents. The parents already had the genetics that expressed the phenotypic trait of the 'long neck'; it did not 'grow' a long  neck merely by stretching. Of course, 'long' is a subjective word. Somatic cells are not passed on (environmentally).
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
19. Which of the following is the  best  definition of evolution?
Background image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}