212_Sample_exam

212_Sample_exam - Biology212SampleExamQuestions

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
Biology 212 Sample Exam Questions 16.  A particular eukaryotic protein is 300 amino acids long. Which of the following could  be the number of nucleotides in the gene  that codes for this protein?  (*be careful!*) a. 3 b. 100 c. 300 d. 900 e. 1800 explain your answer:
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
gene  that encodes a small peptide in a prokaryotic organism. Describe the  sequence of events that will take place to convert this genetic information into a poly peptide  (Both transcription and  translation!) .  Be as complete as possible and be sure to indicate the sequence of the mRNA and the sequence of the peptide that  are created (see the universal code on the last page of your test).  promoter region 5’ (ATGACGTATAA) TGACCGTACATGAGTAATACATAAATCAG 3’ 3’ (TACTGCATATT) ACTGGCATGTACTCATTATGTATTTAGTC 5’ 18. During a study session about evolution, one of your classmates remarks “ The giraffe stretched its neck while reaching for higher  leaves so its offspring inherited longer necks as a result.” What would you say to correct your fellow student’s misconception? 19. Which of the following is the 
Background image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

Page1 / 5

212_Sample_exam - Biology212SampleExamQuestions

This preview shows document pages 1 - 3. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online