{[ promptMessage ]}

Bookmark it

{[ promptMessage ]}

Lab_2_2011_worksheet - Mic 433 Microbial Genomics Lab...

Info icon This preview shows pages 1–2. Sign up to view the full content.

View Full Document Right Arrow Icon
Mic 433, Microbial Genomics Lab exercise #2 Due date: January 25 or 27 Name: Mary Ellen Hoinski The goal of this laboratory exercise is to explore some of the major gene and genome databases and to become familiar with retrieving information available at these sites. 1. A teenaged male collapsed during a mountain-climbing exercise and was admitted to a nearby hospital emergency room. The attending physician suspected a particular disorder and ordered a molecular diagnostic test. The following sequence was amplified by PCR and analyzed. agctcctgcttagagcatgtaggagacctggtcagcagcatctccatctttctgcagctt gaccctcaacaccaaccatgggcatatcctggtggattactccaagaacctggtgacgga ggacgtgatgcggatgctggtccacttggtaat a) Based on a blastn search ( http://www.ncbi.nlm.nih.gov/blast/Blast.cgi ) of GenBank (human genome (reference only), what gene does this sequence most likely come from? Homo sapiens glucose phosphate isomerase (GPI), mRNA Length=2075 b) How is the sequence you submitted different from the best-matching sequence in GenBank? Does this cause a change in the protein sequence (blastx, use refseq protein)? What is the change?
Image of page 1

Info icon This preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Image of page 2
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}

What students are saying

  • Left Quote Icon

    As a current student on this bumpy collegiate pathway, I stumbled upon Course Hero, where I can find study resources for nearly all my courses, get online help from tutors 24/7, and even share my old projects, papers, and lecture notes with other students.

    Student Picture

    Kiran Temple University Fox School of Business ‘17, Course Hero Intern

  • Left Quote Icon

    I cannot even describe how much Course Hero helped me this summer. It’s truly become something I can always rely on and help me. In the end, I was not only able to survive summer classes, but I was able to thrive thanks to Course Hero.

    Student Picture

    Dana University of Pennsylvania ‘17, Course Hero Intern

  • Left Quote Icon

    The ability to access any university’s resources through Course Hero proved invaluable in my case. I was behind on Tulane coursework and actually used UCLA’s materials to help me move forward and get everything together on time.

    Student Picture

    Jill Tulane University ‘16, Course Hero Intern