Lab_2_2011_worksheet

Lab_2_2011_worksheet - Mic 433, Microbial Genomics Lab...

Info iconThis preview shows pages 1–2. Sign up to view the full content.

View Full Document Right Arrow Icon
Mic 433, Microbial Genomics Lab exercise #2 Due date: January 25 or 27 Name: Mary Ellen Hoinski The goal of this laboratory exercise is to explore some of the major gene and genome databases and to become familiar with retrieving information available at these sites. 1. A teenaged male collapsed during a mountain-climbing exercise and was admitted to a nearby hospital emergency room. The attending physician suspected a particular disorder and ordered a molecular diagnostic test. The following sequence was amplified by PCR and analyzed. agctcctgcttagagcatgtaggagacctggtcagcagcatctccatctttctgcagctt gaccctcaacaccaaccatgggcatatcctggtggattactccaagaacctggtgacgga ggacgtgatgcggatgctggtccacttggtaat a) Based on a blastn search ( http://www.ncbi.nlm.nih.gov/blast/Blast.cgi ) of GenBank (human genome (reference only), what gene does this sequence most likely come from? Homo sapiens glucose phosphate isomerase (GPI), mRNA Length=2075 b) How is the sequence you submitted different from the best-matching sequence in GenBank? Does this cause a change in the protein sequence (blastx, use refseq protein)? What is the change? 1)
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Image of page 2
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 03/01/2011 for the course MMG 433 taught by Professor Britton,r during the Spring '08 term at Michigan State University.

Page1 / 3

Lab_2_2011_worksheet - Mic 433, Microbial Genomics Lab...

This preview shows document pages 1 - 2. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online