Answers - Worksheet 06 - BIO 311C (F09 MM & TPW)

Answers - Worksheet 06 - BIO 311C (F09 MM & TPW) - WS...

Info icon This preview shows pages 1–2. Sign up to view the full content.

View Full Document Right Arrow Icon
WS 06 / BIO 311C F09 / MM & TPW / UT AUSTIN BIO 311C Discussion Fall 2009 (MM & TPW) Worksheet 6 – Answers Key , Week of November 30, 2009 1. Shown below is a 40 base pair segment of a hypothetical gene. It includes the promoter and the first codons of the gene. The sequences of both strands of the DNA duplex are shown: the top strand reads 5’ to 3’ left to right (1 to 40); the bottom, complimentary, strand reads 5’ to 3’ right to left (40 to 1). 5’- TGTTGTGTGG AATTGTGAATGAACAGCGTG AACCATTAAT -3’ 3’- ACAACACACC TTAACACTTA CTTGTCGCAC TTGGTAATTA -5’ i) Synthesis of the mRNA starts at the boxed A / T base pair indicated by the above (#11) and proceeds left to right on the sequence above. Write the sequences of the first 10 nucleotides of the resulting mRNA. 5’ AAUUGUGAAU… 3’ ii) The mRNA you just wrote has almost the same sequence as one of the DNA strands. Which DNA strand is this? What is the difference between it and the mRNA sequence? The mRNA has the same sequence as the DNA strand that oriented 5 to 3 , because all nucleic acids are made in the 5 to 3 direction. Synthesis is directed by a template that runs antiparallel to the newly synthesized molecule. The mRNA is the same except that wherever there is a T in the DNA, there is a U in the mRNA. iii) What are the amino acid sequences of the polypeptide that would result from translation of the mRNA? A table of the genetic code can be found in your textbook. H 3 N + -Met-Asn-Ser-Val-Asn-His-COO Protein synthesis begins at the start codon, usually the first AUG of the mRNA. The correct
Image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Image of page 2
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}

What students are saying

  • Left Quote Icon

    As a current student on this bumpy collegiate pathway, I stumbled upon Course Hero, where I can find study resources for nearly all my courses, get online help from tutors 24/7, and even share my old projects, papers, and lecture notes with other students.

    Student Picture

    Kiran Temple University Fox School of Business ‘17, Course Hero Intern

  • Left Quote Icon

    I cannot even describe how much Course Hero helped me this summer. It’s truly become something I can always rely on and help me. In the end, I was not only able to survive summer classes, but I was able to thrive thanks to Course Hero.

    Student Picture

    Dana University of Pennsylvania ‘17, Course Hero Intern

  • Left Quote Icon

    The ability to access any university’s resources through Course Hero proved invaluable in my case. I was behind on Tulane coursework and actually used UCLA’s materials to help me move forward and get everything together on time.

    Student Picture

    Jill Tulane University ‘16, Course Hero Intern