Answers - Worksheet 06 - BIO 311C (F09 MM & TPW)

Answers - Worksheet 06 - BIO 311C (F09 MM & TPW) - WS...

Info iconThis preview shows pages 1–2. Sign up to view the full content.

View Full Document Right Arrow Icon
WS 06 / BIO 311C F09 / MM & TPW / UT AUSTIN BIO 311C Discussion Fall 2009 (MM & TPW) Worksheet 6 – Answers Key , Week of November 30, 2009 1. Shown below is a 40 base pair segment of a hypothetical gene. It includes the promoter and the first codons of the gene. The sequences of both strands of the DNA duplex are shown: the top strand reads 5’ to 3’ left to right (1 to 40); the bottom, complimentary, strand reads 5’ to 3’ right to left (40 to 1). 5’- TGTTGTGTGG AATTGTGAATGAACAGCGTG AACCATTAAT -3’ 3’- ACAACACACC TTAACACTTA CTTGTCGCAC TTGGTAATTA -5’ i) Synthesis of the mRNA starts at the boxed A / T base pair indicated by the above (#11) and proceeds left to right on the sequence above. Write the sequences of the first 10 nucleotides of the resulting mRNA. 5’ AAUUGUGAAU… 3’ ii) The mRNA you just wrote has almost the same sequence as one of the DNA strands. Which DNA strand is this? What is the difference between it and the mRNA sequence? The mRNA has the same sequence as the DNA strand that oriented 5 ± to 3 ± , because all nucleic acids are made in the 5 ± to 3 ± direction. Synthesis is directed by a template that runs antiparallel to the newly synthesized molecule. The mRNA is the same except that wherever there is a T in the DNA, there is a U in the mRNA. iii) What are the amino acid sequences of the polypeptide that would result from translation of the mRNA? A table of the genetic code can be found in your textbook. H
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Image of page 2
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 03/04/2011 for the course BIO 100 taught by Professor Nicolaplows during the Spring '08 term at Central Connecticut State University.

Page1 / 3

Answers - Worksheet 06 - BIO 311C (F09 MM & TPW) - WS...

This preview shows document pages 1 - 2. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online