Genetics_unit_review_questions

Genetics_unit_review_questions - Review Questions for Bis2A...

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
Review Questions for Bis2A (from Gerhart, 2008) DNA structure and replication (Ch 12) Review questions 1. Draw a nucleotide using the symbols shown below. 2. Now, draw a single-stranded DNA molecule using the symbols to make the nucleotides. Show where the next nucleotide would attach to the strand. What type of bond attaches these nucleotides to each other? 3. Draw a double-stranded DNA molecule using the symbols shown above (see fig. 12.5 to check your work). 4. How is a triphosphate nucleotide different from, and similar to, ATP? 5. What types of bonds are broken when the DNA strands separate during DNA replication? 6. Complete the diagram of DNA replication. Label the leading and lagging strands on the newly made DNA, and 5’ and 3’ ends. In what direction is the new strand of DNA made? 7. What direction (from left to right, or from right to left) would DNA polymerase be moving as it replicated the top strand of DNA in the figure below? 3’-AATTTGTTAGGCC-5’ 5’-TTAAACAATCCGG-3’ 8. If letter (b) represents the 5’ end of the strand it is pointing to, where is (are) the most likely place(s) to see Okazaki fragments? (figure from Freeman 2/e) 9. If you were told that the sequence below was replicated from left to right, which strand would be continuously replicated and which one would be copied in a patchwork fashion? 5' AATGCCGTATCGGATTCGAATC 3' 3' TTACGGCATAGCCTAAGCTTAG 5' = base = phosphate = sugar 3’ 5’ 5’ 3’
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Gene Expression (Ch 13) Review questions 1. In the diagram of a piece of DNA below, which number logically corresponds to which description? -Protein coding region -Region encoded by a gene -Translation start site -Translation stop site -Transcription start site -Transcription stop site 2. Fill in the sequence of an mRNA made from the DNA below, if the promoter is located to the left. 3. How is RNA polymerase controlled? What determines where RNA polymerase starts and stops transcription? How does the enzyme know which strand of DNA to read? 4. What is a codon? Does RNA polymerase recognize codons? Do codons have a function while in the DNA? 5. What is “universal” about the genetic code? 6. What is Crick’s Central Dogma? What is a recent modification of his idea? 7. Determine the amino acid sequence encoded by this open reading frame of mRNA (you’ll need the universal genetic code in table 13.1). 5’AUGCCUGACUUUAAGUAG 3’ 8. In what direction is RNA synthesized? Does RNA polymerase need a primer? 9. Label the diagram of protein synthesis using the following terms, A, P, and E site, mRNA, codon, anticodon, ribosome, amino acid, amino end, carboxyl end, 3’ end, 5’ end, tRNA. 1
Background image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 03/08/2011 for the course BIS 2A taught by Professor Grossberg during the Fall '08 term at UC Davis.

Page1 / 10

Genetics_unit_review_questions - Review Questions for Bis2A...

This preview shows document pages 1 - 3. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online