Key_Genetics_chapterproblems

Key_Genetics_chapterproblems - Key to Select Questions -...

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
Key to Select Questions --- Genetics Unit Review DNA structure and replication (Ch 12) Review questions 1. Draw a nucleotide using the symbols shown below. = phosphate = base (Don’t forget the final carbon is found above the flat 5-cornered plane formed by the other four carbons and the oxygen) 5. Complete the diagram of DNA replication. Label the leading and lagging strands on the newly made DNA, and 5’ and 3’ ends. In what direction is the new strand of DNA made? DNA is always built in the 5’ to 3’ direction. When built toward the fork (where new single- stranded DNA is being exposed) it is built as a continuous ‘leading’ strand. When built away from the fork, it is built in segments as new single-stranded DNA is becomes available, and is called the lagging strand. 7. If letter (b) represents the 5’ end of the strand it is pointing to, where is (are) the most likely place(s) to see Okazaki fragments? Since (b) is a 5’ end, and DNA is always built 5’ to 3’ and antiparallel to the template, the fragment at (c) must be built toward the right hand replication fork. Similarly, (e) must be built away from the right hand replication fork. (a) is built in the same direction as (e), but is moving toward the left hand replication fork. (d) is moving in the same direction as (c) but is moving away from the left hand replication fork. Lagging strands are found at (d) and (e) while leading strands are found at (a) and (c). 8. If you were told that the sequence below was replicated from left to right, which strand would be continuously replicated and which one would be copied in a patchwork fashion? 5' AATGCCGTATCGGATTCGAATC 3' 3' TTACGGCATAGCCTAAGCTTAG 5'
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
You are told the DNA is replicated from left to right, so the branching part of the fork (where new DNA is being exposed) must be towards the right. The lower strand would provide the template for the leading strand, because it is built 5’ to 3’ and toward the right. The upper DNA strand would provide the template for the lagging strand, because it is built 5’ to 3’ toward the left. Gene Expression (Ch 13) Review questions 1. In the diagram of a piece of DNA below, which number logically corresponds to which description? 5-Protein coding region because it must be shorter than the mRNA transcript (there is an untranslated leader, then embedded within the mRNA sequence is the ribosome-binding sequence, then the start codon, followed by the coding section, a stop codon, and a trailing base sequence that is never translated). 6-Region encoded by a gene because the gene must be longer than the amino acid encoding region (to include a promoter, untranslated leader, untranslated trailer, and termination sequence) If the gene read left to right, then 1= Transcription start site; 2 = Transcription stop site The mRNA is read in the same direction it is made, so then 2 = Translation start site; 3=Translation stop site (If you assume the gene is read from right to left, then start of transcription is 4, and start of translation is 3). 3. How is RNA polymerase controlled?
Background image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 03/08/2011 for the course BIS 2A taught by Professor Grossberg during the Fall '08 term at UC Davis.

Page1 / 8

Key_Genetics_chapterproblems - Key to Select Questions -...

This preview shows document pages 1 - 3. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online