{[ promptMessage ]}

Bookmark it

{[ promptMessage ]}

PSET4Q - Name 2010 7.012 Problem Set 4 Section TA Please...

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
Name_____________________________________ Section_______ TA_____________ 1 2010 7.012 Problem Set 4 Please print out this problem set and answer the questions on the printout. Answers to this problem set are to be turned in at the box outside 68-120 by 1:15 pm, Friday Oct 15 th . Question 1 The following is a partial sequence of a double stranded bacterial DNA that encodes a short peptide. Please note that the promoter for this gene is not shown. CTGCTTCAATATGAACCAGTGGAGTGCCTTAAAGATCTGACGAAACGTCACGGAATCTCTAGACTGCTTCAAT GACGAAGTTATACTTGGTCACCTCACGGAATTTCTAGACTGCTTTGCAGTGCCTTAGAGATCTGACGAAGTTA a) For the sequence above, i. Circle the template strand for transcription. ii. Label the 5’ and the 3’ ends of each strand. iii. Indicate the direction of transcription by an arrow. b) Give the sequence of i. The first 10 nucleotides of the mRNA transcript and label its 5’ and 3’ ends. Note: You may assume that transcription starts from the first base in the sequence above. ii. The peptide produced from this mRNA transcript and label its N and C ends. Please note: A codon chart is provided on the last page of this problem set. c) Give the base sequence of the anti-codon that inserts the fourth amino acid into the peptide and label its 5’ and the 3’ ends. d) The following are two mutant versions of the wild-type DNA sequence that is shown above. The mutated base pair in both versions is bold and underlined. Mutant 1: CTGCTTCAATATGAAC T AGTGGAGTGCCTTAAAGATCTGACGAAACGTCACGGAATCTCTAGACTGCTTCAAT GACGAAGTTATACTTG A TCACCTCACGGAATTTCTAGACTGCTTTGCAGTGCCTTAGAGATCTGACGAAGTTA Mutant 2: CTGCTTCAATATGAA T CAGTGGAGTGCCTTAAAGATCTGACGAAACGTCACGGAATCTCTAGACTGCTTCAAT GACGAAGTTATACTT A GTCACCTCACGGAATTTCTAGACTGCTTTGCAGTGCCTTAGAGATCTGACGAAGTTA For each mutant version, i) Write the sequence of the peptide that is produced. Label its N and C termini. Mutant 1: Mutant 2: ii) Identify the type of point mutation. Choose from silent/ missense/ nonsense/ frameshift mutations. Mutant 1: Mutant 2: Wild-type DNA sequence:
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Name_____________________________________ Section_______ TA_____________ 2 Question 1 continued e) Would the substitution of a base that is a part of the 4 th codon in the given wild-type DNA sequence always change the resulting peptide sequence? Explain your answer. f) Would the substitution of a base that is a part of the 3 rd codon in the given wild-type DNA sequence always change the resulting peptide sequence? Explain your answer. Question 2 a) For each of the following eukaryotic genes indicate the location of the following components on the appropriate molecules (DNA / RNA) on the diagram. (As an example, the origin of replication (ori) is shown as a boxed region on the double stranded DNA).
Background image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}