PSET4S - Solution key - 2010 7.012 Problem Set 4 Question 1...

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
1 Solution key - 2010 7.012 Problem Set 4 Question 1 The following is a partial sequence of a double stranded bacterial DNA that encodes a short peptide. Please note that the promoter for this gene is not shown. CTGCTTCAATATGAACCAGTGGAGTGCCTTAAAGATCTGACGAAACGTCACGGAATCTCTAGACTGCTTCAAT GACGAAGTTATACTTGGTCACCTCACGGAATTTCTAGACTGCTTTGCAGTGCCTTAGAGATCTGACGAAGTTA a) For the sequence above, Circle the template strand for transcription. Label the 5’ and the 3’ ends of each strand. Indicate the direction of transcription by an arrow. b) Give the sequence of The first 10 nucleotides of the mRNA transcript and label its 5’ and 3’ ends. Note: You may assume that transcription starts from the first base of the sequence above. 5’CUGCUUCAAU3’ The peptide produced from this mRNA transcript and label its N and C ends. Please note: A codon chart is provided on the last page of this problem set. N-met-asn-gln-trp-ser-ala-leu-lys-ile-C c) Give the base sequence of the anti-codon that inserts the fourth amino acid into the peptide and label its 5’ and the 3’ ends. 3’ACC 5’ d) The following are two mutant versions of the wild-type DNA sequence that is shown above. The mutated base pair in both versions is bold and underlined. Mutant 1: CTGCTTCAATATGAAC T AGTGGAGTGCCTTAAAGATCTGACGAAACGTCACGGAATCTCTAGACTGCTTCAAT GACGAAGTTATACTTG A TCACCTCACGGAATTTCTAGACTGCTTTGCAGTGCCTTAGAGATCTGACGAAGTTA Mutant 2: CTGCTTCAATATGAA T CAGTGGAGTGCCTTAAAGATCTGACGAAACGTCACGGAATCTCTAGACTGCTTCAAT GACGAAGTTATACTT A GTCACCTCACGGAATTTCTAGACTGCTTTGCAGTGCCTTAGAGATCTGACGAAGTTA For each mutant version, i) Write the sequence of the peptide that is produced. Label N and C termini. Mutant 1: N-met-asn-C Mutant 2: N-met-asn-gln-trp-ser-ala-leu-lys-ile-C ii) Identify the type of point mutation. Choose from silent/ missense/ nonsense/ frameshift. Mutant 1: This is a nonsense mutation since a premature stop codon is inserted. Mutant 2: This is a silent mutation, since the peptide sequence is not changed by this mutation. Wild-type DNA sequence: 5’ 3’ 3’ 5’
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
2 Question 1 continued e) Would the substitution of a base that is a part of the 4 th codon in the given wild-type DNA sequence always change the resulting peptide sequence? Explain your answer. There is only one codon for amino acid tryptophan. Therefore any substitution in this codon will change the amino acid and the resulting protein sequence. f) Would the substitution of a base that is a part of the 3 rd codon in the given wild-type DNA sequence always change the resulting peptide sequence? Explain your answer. There are two codons for asn – 5’AAU 3’ (codon 1) and 5’AAC 3’ (codon 2). If the 3 rd base of codon 2 is changed to “T” you will see the insertion of asn at the same position in the peptide. However if you change the third base of codon 1 to any other base, or change the first or second base pair the amino acid encoded will change Question 2 a) For each of these genes indicate the location of the following components on the appropriate molecules (DNA / RNA) on the diagram.
Background image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

Page1 / 6

PSET4S - Solution key - 2010 7.012 Problem Set 4 Question 1...

This preview shows document pages 1 - 3. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online