7.012_Section_6-solution_key-_2010

7.012_Section_6-solution_key-_2010 - 1 Solution key - 7.012...

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: 1 Solution key - 7.012 Recitation 6 - 2010 Questions: 1. You radiolabel the bacterial cells with N 15 . You then grow them for three generations in N 14 containing medium and separate the bands based on the difference in their density. Draw the band profile after the 1 st , 2 nd and 3 rd generations. 2. Consider the following segment of the DNA that is a part of a much larger molecule constituting a chromosome. The sequence of region 1 is shown below. Region 1: 5’…ATTCGTACGATCGACTGACTGACAGTC…3’ 3’…TAAGCATGCTAGCTGACTGACTGTCAG…5’ i. If we assume that a fragment of the lagging strand is made from region 1, what will be its sequence? Label the 5’ and the 3’ ends. 5’…ATTCGTACGATCGACTGACTGACAGTC…3’ ii. Why is DNA synthesis continuous at one strand and discontinuous at the other strand? This is because the two strands of DNA duplex are anti-parallel but the replication always occurs in a 5’ → 3’direction. Accordingly, the synthesis is continuous at one strand and discontinuous at the other strand 3’direction....
View Full Document

This note was uploaded on 03/12/2011 for the course BIO 7.012 taught by Professor Lander during the Fall '10 term at MIT.

Ask a homework question - tutors are online