7.012_Section_7-_solution_key_-2010

7.012_Section_7-_solution_key_-2010 - Solution Key - 7.013...

Info iconThis preview shows pages 1–2. Sign up to view the full content.

View Full Document Right Arrow Icon
1 Solution Key - 7.013 Recitation 7 - 2010 Questions: 1. The following is a partial sequence from the hypothetical gene, gene X. The boxed region is the promoter, and the direction of transcription is indicated by the arrow. Transcription begins at and includes the first G/C base pair after the box. 5’ GGACCGCGGGGCAGGATTGCTCCGGGCTGTTTCATGACTTGTCAGGTGGGATGACTTGGATGGAAAAGTAGAAGGTCATG +---------+---------+---------+---------+---------+---------+---------+--------- 3’ CCTGGCGCCCCGTCCTAACGAGGCCCGACAAAGTACTGAACAGTCCACCCTACTGAACCTACCTTTTCATCTTCCAGTAC 5’ GGGTGGCCAACTTGGGCGAGAAAAGGTATATAAAGGTCTCTTGCTCCCATCTACTGCCCCATTTGTAGGTATTCCAGCAG +---------+---------+---------+---------+---------+---------+---------+--------- 3’ CCCACCGGTTGAACCCGCTCTTTTCCATATATTTCCAGAGAACGAGGGTAGATGACGGGGTAAACATCCATAAGGTCGTC 5’ ATCAGACAACGTCTCATGGGAGTACTTGGATGGAAGAGTAGAAGGTCATGACCAACCTCTTCCAATCCAACCACAAACAG +---------+---------+---------+---------+---------+---------+---------+--------- 3’ TAGTCTGTTGCAGAGTACCCTCATGAACCTACCTTCTCATCTTCCAGTACTGGTTGGAGAAGGTTAGGTTGGTGTTTGTC 5 AAAATCAGCCAATATGTCCGACTTCGAGAACAAGAACCCCAACAACGTCCTTGGCGGACACAAGGCCACCCTTCACAACC
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Image of page 2
This is the end of the preview. Sign up to access the rest of the document.

Page1 / 2

7.012_Section_7-_solution_key_-2010 - Solution Key - 7.013...

This preview shows document pages 1 - 2. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online