protein-synthesis

protein-synthesis - PHYSIOLOGY PHYSIOLOGY Signal...

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: PHYSIOLOGY PHYSIOLOGY Signal Transduction and Protein Signal Synthesis Synthesis DNA DNA DNA – – – Deoxyribonucleic Acid Twisted ladder or double helix Nucleotides » Composed of alternating sugar (Deoxyribose) and Composed phosphate molecules and phosphate » Nitrogen bases Purines = adenine and guanine Pyrimidines = thymine cytosine DNA DNA Purines bond with Pyrimidines – Complementary base pairs » Adenine with Thymine » Guanine with Cytosine DNA DNA Purines bond with Pyrimidines – Complementary base pairs » Adenine with Thymine » Guanine with Cytosine Nucleoside – Sugar bonding with a base Nucleotide – Adding a phosphate to a nucleoside Phosphates attach to the 5’ carbon of the sugar Orientation of DNA The carbon atoms on the sugar ring are numbered for reference. The 5’ and 3’ hydroxyl groups (highlighted on the left) are used to attach phosphate groups. The directionality of a DNA strand is due to the orientation of the phosphate-sugar backbone. DNA is a double helix P P P P P P P P P 5’ C A G DNA has directionality. P G T A P C Two nucleotide chains together wind into a helix. Hydrogen bonds between paired bases hold the two DNA strands together. DNA strands are antiparallel. 3’ C P G C G P T A sugar and phosphate “backbone” connects nucleotides in a chain. P 3’ 5’ DNA DNA A chromosome – 23 pair = diploid – 23 = haploid; sex cells – Duplicating DNA structure tightly packed Duplicating around histone proteins to form a nucleosome. around DNA DNA A gene – A series of bases that occupy a specific location (locus) on a series chromosome chromosome – The code of a single protein or polypeptide Genetic Alphabet – Triplet = Three nucleotides on DNA with their corresponding base Triplet pairs making up the code of a single amino acid pairs – Codon = Three successive nucleotides on RNA with their Codon corresponding base pairs making up the code of a single amino acid acid – 20 amino acids – A series of amino acids makes up a protein DNA DNA Consists of 3 billion base pairs – Codes for about 50 to 100,000 genes – Genes may exist in alternate forms = alleles » One allele from mom and one allele from dad – Nucleotide changes or mutations may occur in a gene » Sickle cell anemia Sickle – In a healthy population, a gene may exist in multiple In alleles alleles – Genetic Polymorphism = Multiple different forms at a Genetic gene locus in a population » Basis for DNA typing using MHC Terminology – Allele » An alternate form of a gene – Locus » Location of a gene on a chromosome – Gene » Genetic code or “blueprint” for the cell to build one particular protein Two types of nucleic acids RNA Usually Has DNA single-stranded Usually Has double-stranded uracil as a base as the sugar thymine as a base as the sugar Ribose Carries Deoxyribose Carries protein-encoding information Can RNA-encoding information Not be catalytic catalytic Protein Synthesis Proteins are necessary for cell functions Proteins Protein synthesis is under nuclear direction Protein ⇒ DNA specifies Proteins DNA DNA ? mRNA ? Protein How can only 4 bases in DNA encode > bases 20 different aa in protein? 20 1 letter word: 1 base = 1 aa letter 2 letter word: 2 bases = 42 = 16 aa letter 3 letter word: 3 bases = 43 = 64 aa 3 letter words = base triplets or codons codons Redundancy of Genetic Code (p 115) A combination of three bases forms a codon 1 start codon start 3 stop codon 60 other codons for 60 19 aa 19 RNA RNA Definitions – Exon » Amino acid specifying informational sequences in Amino the genes of higher organisms the – Intron » Noncoding segments or portions of DNA that ranges Noncoding from 60 to 100,000 nucleotides long from Transcription Transcription DNA is transcribed into complementary mRNA mRNA by RNA Polymerase + nucleotides + Mg2+ + ATP Gene = elementary unit of inheritance Compare to Fig. 4-33 Transcription Transcription First steps in protein synthesis that occurs First completely within the nucleus completely DNA is used as a template to create a small DNA single strand of mRNA that can leave through the nuclear pore. through The enzyme RNA polymerase plus The RNA magnesium or manganese ions along with magnesium ATP are needed in this process. ATP DNA is used as a template for creation of RNA using the enzyme RNA polymerase. DNA 5’ 3’ 3’ CAGTAAGCC 5’ GT CA TT CGG Transcription The new RNA molecule is formed by incorporating nucleotides that are complementary to the template strand. DNA coding strand 5’ 3’ GTCA TTCGG 3’ GUCAUUCGG CAGTAAGCC DNA template strand 3’ 5’ DNA Transcription 5’ RNA Transcription Transcription Promoter – Sequence on DNA where the RNA Sequence polymerase attaches to begin transcription transcription – A region at the beginning of a gene that must region be activated before transcription can begin. be – This region is not transcribed into mRNA Transcription Transcription Transcription Factors – Binds to DNA and activates the promoter » Tells the RNA polymerase where to bind to the DNA » RNA polymerase moves along the DNA molecule and RNA “unwinds” the double strand by breaking hydrogen bonds between base pairs between – Sense strand » Guides RNA polymerase in RNA synthesis – Antisense strand » Sits idly by and is not transcribed Transcription Transcription Each base of the DNA sense strand pairs Each with a complementary mRNA base with – AGTAC on DNA – UCAUG on mRNA Uracil is substituted for Thymine Ribose sugar is used as the backbone of Ribose mRNA instead of Deoxyribose sugar Initiation of transcription Transcription begins at the 5’ end of the gene in a region called the promoter. The promoter recruits TATA protein, a DNA binding protein, which in turn recruits other proteins. TATA binding protein Promoter DNA GG TATA CCC TATA box Transcription begins Gene sequence to be transcribed Transcription factor mRNA processing mRNA Alternative splicing occurs – Enzymes clip segments out of the middle or off Enzymes the ends of mRNA strands the » Introns – mRNA segments are spliced back together by mRNA the spliceozyme enzyme the » Exons The processes mRNA leaves through the The nuclear pore and attaches to a ribosome nuclear mRNA Contains the coded information for the amino acid sequence of a protein 3 main parts: – 5' leader sequence - important for the start of protein synthesis. – Coding Sequence - the sequence that codes for the amino acid. – 3’ trailer sequence - poly A tail. Messenger RNA undergoes three (or four) post-transcriptional modifications 1. Capping of 5’ end 2. Additional of poly A tail to 3’ end 3. Removal of introns 4. Editing of RNA (rarely) EUKARYOTES ONLY!!!!!!!!!!!!!!!! 5’ capping. Involves the addition of a guanine (usually 7-methylguanosine) to the terminal 5’ nucleotide. The enzyme that completes this process is called a capping enzyme. The 5’ cap is required for the ribosome to bind to the mRNA as the initial step of translation. Addition of a 3’poly A tail. This poly(A) tail is usually about 50 - 250 bps of adenine in length. There is no DNA template for this tail? Poly A tails are found on most mRNA molecules but not all (ex. histones mRNA have no poly A tail). In general, a eukaryotic mRNA molecule is longer than the required transcript. The enzyme RNA endonuclease cleaves the molecule at the poly(A) addition site to generate a 3’ OH end. The poly A tail is important for determining the stability of the mRNA molecule so the mRNA doesn’t degrade. Translation Translation Translation begins when mRNA binds to a Translation ribosome in the cytoplasm of the cell. ribosome Translation Translation mRNA is translated into string of aa (= polypeptide) (= mRNA 2 important components ?? mRNA + ribosomes + tRNA meet in cytoplasm Anticodon pairs with mRNA codon ⇒ aa determined Amino acids are linked via peptide bond. The Genetic Code The The code has start and stop signals. AUG (methionine) is the common start codon AUG start Methionine can also be used WITHIN a polypeptide GUG may also be used as a start codon. There are three stop codons. UAG UAA UGA UGA All three are chain termination codons. All Ribosomal RNA Large and small subunits Binding sites – One for mRNA – Three for tRNA » P site = Peptidyl-tRNA site » A site = Aminoacyl-tRNA site » E site = Exit site Transfer RNA Transfer The correct amino acid is added to the The growing polypeptide only if: growing – 1 - The appropriate amino acid is added to the The tRNA by aminoacyl-tRNA synthetases. tRNA – 2 – Complementary binding occurs between the Complementary codon of the mRNA and the anticodon of the tRNA. tRNA. Translation (An Overview) Translation is defined as protein synthesis. Occurs on ribosomes, where the genetic information is translated from the mRNA to a protein. mRNA is translated in the 5’ to 3’ direction. Amino acids are brought to the ribosome bound to a specific tRNA molecule. The mRNA and tRNA are responsible for the correct recognition of each amino acid in the growing polypeptide Initiation A small ribosomal subunit binds to both mRNA at the 5’ cap along with a specific initiator tRNA – The initiator tRNA carries methionine tRNA’s anticodon binds with the codon on mRNA The large ribosomal subunit attaches to form the translation initiation complex. The initiation complex is held together by proteins called initiation factors Initiation The tRNA sits in the P site of the ribosome The A site is vacant The methionine is at the N-terminus of the growing protein The carboxyl end is called the C-terminus All proteins grow from the N to the Cterminus Elongation Binding of the aminoacyl-tRNA to the ribosome formation of a peptide bond The movement (translocation) of the ribosome along the mRNA, one codon at a time. Elongation Three step cycle – The ribosome will move 5’ to 3’ on the mRNA Step one – The anticodon of an incoming aminoacyltRNA base-pairs with the complementary mRNA codon in the A site – GTP hydrolysis occurs Elongation Step two – The large ribosomal subunit catalyzes the formation of a peptide bond – Hydrogen bonds break between the t-RNA in the P site and between the codon and anti-codon Step three – translocation – The ribosomes moves along the mRNA one codon – The tRNA that was in the A site is now in the P site – The tRNA in the P site exits through a tunnel in the rRNA called the E site – The next tRNA enters in the empty A site Termination Termination is usually signaled by one of the three stop codons UAG, UAA or UGA. There are a number of “helper” proteins involved (e.g. termination factors and release factors). GTP is necessary to break the complex apart Translation initiation Leader sequence 5’ mRNA UUCGUCAUGGGAUGUAAGCGAA UAC Small ribosomal subunit 3’ mRNA Assembling to begin translation Met Initiator tRNA Translation Elongation Ribosome 5’ mRNA AUGGGAUGUAAGCGA UACCCU 3’ P Amino acid Met Gly tRNA A Large ribosomal subunit Translation Elongation 5’ mRNA AUGGGAUGUAAGCGA UACCCU 3’ A P Met Gly Cys AC A Translation Elongation 5’ mRNA AUGGGAUGUAAGCGA CCUACA U A C 3’ P et M Gly Cys A Translation Elongation 5’ mRNA AUGGGAUGUAAGCGA 3’ P U A C CCUACA U U C A Gly Me t Cys Lys Translation Elongation mRNA 5’ AUGGGAUGUAAGCGA U 3’ ACAUUC P Lengthening polypeptide (amino acid chain) C C Gl y t Me Cys Lys A Translation Elongation 5’ mRNA AUGGGAUGUAAGCGA U 3’ ACAUUC GC U P Gl y Me t C C Cys Lys Arg A Translation Elongation 5’ mRNA AUGGGAUGUAAGCGA U 3’ ACAUUC GC U P C C Cys Gl y t Me Lys Arg A Translation Elongation Stop codon 5’ mRNA AUGGGAUGUAAGCGA UAA C A U U CGC U A P A Gly M et Cys Lys Arg Release factor Translation Termination Ribosome reaches stop codon Stop codon 5’ mRNA AUGGGAUGUAAGCGA UAA GC U P U U C Release factor Lys Arg Met Gly Cys A Translation Termination Once stop codon is reached, elements disassemble. AU GG GAUG U AA GC GA U AA U P GC Release factor Arg Cy s s Ly Met Gly A Translation Modifications Translation Protein folding Glycosylation – Addition of glycogen to the protein by the Addition Golgi Apparatus Golgi – Create a glycoprotein Vesiculation – Protein is surrounded by a vesicle Protein Exocytosis will then occur Post – Translational protein modifications: Folding, cleavage, additions ⇒ glyco- , lipo- proteins Protein Sorting Protein No signal sequence ⇒ protein stays in cell protein No Signal sequence ⇒ protein destined for translocation into Signal organelles or for export For “export proteins”: Signal sequence leads For growing polypeptide chain across ER membrane into ER lumen into Modifications in ER Modifications Transition vesicles to Golgi apparatus for further Golgi modifications modifications Transport vesicles to cell Transport membrane membrane Signal Transduction Signal 1st The signal molecule is a ligand that binds to a receptor. The ligand is also known as the first messenger because it brings information to its target cell target 2nd Ligand-receptor binding activates the receptor d 3rrd The receptor in turn activates one or more intracellular signal molecules intracellular 4th the last signal molecule in the pathway initiates synthesis of target proteins or modifies existing target proteins to create a response target Receptor Proteins Receptor Lipophilic signal molecules – Can diffuse through the phospholipid bilayer Can and bind to cytosolic receptors or nuclear receptors receptors – Steroids are lipophilic Lipophobic signal molecules – Unable to diffuse through the phospholipid Unable bilayer of the cell bilayer – Bind to receptor proteins on the cell membrane Receptor-Enzymes Receptor-Enzymes Transmembrane receptor binds with a ligand on Transmembrane the extracellular surface of the cell the Intracellularly an enzyme is bound to the receptor Intracellularly protein protein – The enzyme is typically a protein kinase (ie. tyrosin The kinase) or guanylyl cyclase kinase) – Guanylyl cyclase converts GTP to cyclic GMP (cGMP) – Adenylyl cyclase converts ATP to cyclic AMP (cAMP) Signal Transduction Signal The process by which an extracellular The signal molecule activates a membrane receptor that in turn alters intracellular molecules to create a response molecules Signal Amplification Signal Turns on signal molecules into multiple Turns second messenger molecules second Steps of Signal Transduction Steps An extracellular signal molecule binds to An and activates a protein or glycoprotein membrane receptor membrane The activated membrane receptor turns on The its associated proteins its – The proteins may activate protein kinases – The proteins may create an intracellular second The messenger messenger Second Messenger Second Second messenger molecules – Alter the ion channels by opening or closing Alter them them – Increase intracellular calcium in order for the Increase calcium to bind to proteins and change their function function – Change enzyme activity Signal molecule binds to the G-protein linked Signal receptors receptors – The protein changes confirmation and activates the The intracellular G protein intracellular The G protein moves horizontally in the The membrane to bind with adenylyl cyclase, an amplifier enzyme amplifier Adenylyl cyclase converts ATP to cyclic AMP cAMP activates protein kinase A Protein kinase A phosphorylates other proteins – There is a cellular response » Such as a protein binding to the promoter site on DNA to start Such transcription transcription » Release of calcium to change enzyme activity Specificity v Competition Specificity Receptors have binding sites for ligands – Different molecules may be able to bind to the Different same receptor same » Ie. Epinephrine and its cousin Norepinephrine These both bind to a class of receptors called Adrenergic These receptors receptors – Alpha and Beta receptors » Alpha has a higher affinity for norepinephrine » B2 receptors have a higher affinity for epinephrine Agonists v Antagonists Agonists When a ligand combines with a receptor – Either the ligand turns the receptor on and Either elicits a response or elicits – The ligand occupies the binding site and The prevents a response from happening prevents Agonist – turns receptors “on” Antagonist – turns receptors “off” ...
View Full Document

Ask a homework question - tutors are online