LS1A 10-21 part2r-4

LS1A 10-21 part2r-4 - LI F E S CI ENC 1a ES PROF. DANIEL...

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: LI F E S CI ENC 1a ES PROF. DANIEL KAHNE PROF. ROBERT LUE OCTOBER 21, 2008 1 Left: Two of the 115 images encoded on the gold record aboard the Voyager I spacecraft, the farthest manmade object from the sun. Voyager I was launched in September 1977 and as of August 22, 2007 is 9.7 billion miles away from the sun. Right: The binary image encoded by the November 16, 1974 radio transmission aimed at the M13 star cluster using the radio telescope at Arecibo, Puerto Rico. Designed to convey the most important elements of our collective knowledge, both messages prominently feature DNA. 2 Lecture 11 Nucleic acids and the chemistry of replicating information 1. The biological role of DNA - Information storage in DNA 2. Double helix structure of DNA - The bases of DNA and base pairing; redundancy - The sugar group in DNA; strand orientation - The chemical driving force for the double helix structure 3. Chemical interactions involving DNA - The phosphate group in DNA; physiological consequences - Major & minor grooves; DNA-binding proteins 3 T h e f la s k v s . t h e c e ll v s . t h e v ir u s RNA genom e envelope glycoproteins DNA genom e core proteins phospholipid envelope T h e fla s k (~ 1 0 c m d ia .) hom ogeneous c h e m ic a l e q u ilib r iu m T h e H u m a n Im m u n o d e fic ie n c y V ir u s (~ 1 0 0 n m d ia .) T h e c e ll (~ 1 0 ∝ m d ia .) c o m p le x in te r n a l s tr u c tu r e fa r fr o m e q u ilib r iu m Dan and Erin have discussed some of the essential differences between the nonliving flask of chemical compounds and the living cell. Although they can contain many of the same components, the flask is at equilibrium while the cell is kept far away from equilibrium, enabling it to harness and transform energy to do work. The ordered complexity of the cell together with the vast range of functional proteins that it contains requires an informational archive in the form of the DNA genome. In this part of the course we are going to explore how this information is encoded in DNA, read, and translated into proteins. This flow of information is a central feature of living cells and is not present in the flask. On the other hand, viruses sit half way between the flask and the cell, in that they are nonliving, and at equilibrium like the flask, but also have a higher order organization that echoes key features of the cell. The Human Immunodeficiency Virus is an important example of a virus that uses single stranded RNA as its genome. While all cells use DNA as the carrier of genomic information, we will learn later on why RNA appears to be an acceptable alternative in viruses like HIV. The outer envelope of HIV is made up of a phospholipid bilayer, which is unsurprising when you consider that it is derived from the plasma membrane as the virus buds from the infected cell. Like a cell, the virus also has proteins imbedded in the bilayer that serve to interact with other proteins outside of the virus. These glycoproteins, which we will discuss later, have covalently attached carbohydrate groups and are essential for HIV’s ability to target and infect cells. Finally, a range of structural proteins such as those that make up the viral core, contribute physical stability to the virus. Despite these components that echo those found in the living cell, the virus has no means of harnessing energy and using it to drive living processes such as protein expression. For this, the virus needs to use a cell to manufacture all the components needed to assemble new viruses. 4 N u c le ic a c id s e n c o d e t h e m o le c u le s o f lif e Information storage device Blueprint House ATGTACGTAGCTAAGTGATCTTGA CTGACGGGTACCGTGCTGATCGTG ACTGATTTTCGAGGAGGATCAATC TAATAATCTAGA Nucleic acid Gene Protein In this lecture we’ll take a detailed look at nucleic acids and learn how their molecular structures contribute to their crucial biological roles. Nucleic acids in the form of DNA and RNA are among the key macromolecules of life. All known living organisms require DNA or RNA at some point during their life cycle, with the vast majority dependent on both nucleic acids. The ubiquity of nucleic acids in forms of life as diverse as bacteria and humans suggests that their biological roles must be very fundamental. Indeed, nucleic acids possess two unique biological features essential to life. Despite the central role that DNA and RNA play both in nature and in science, James Watson (of Watson and Crick) noted at a Harvard lecture that “DNA is the script, but proteins are the actors.” In the next several lectures we will discuss the molecular basis of how the information in your DNA is used to program the synthesis of the proteins in your body— a fundamental concept known as the Central Dogma. Simply stated just like a CD can contain all of the blueprints that specify how to build a house, the Deoxyribonucleic acids or DNA in your cells specifies all of the information to make the proteins that comprise much of the cell. First, nucleic acids carry the information encoding the molecules of life. More specifically, DNA and RNA directly encode the structure of proteins. The physical manifestation of a gene is a segment of DNA that encodes a protein. Nearly all of the molecules within living systems either are proteins that are directly encoded by nucleic acids, or are non-protein molecules that are generated by the actions of proteins (and therefore are indirectly encoded by nucleic acids). The precise way in which nucleic acids encode proteins will be described in detail in an upcoming lecture. For now, however, simply appreciate that nucleic acids are the blueprint for proteins, and therefore the blueprint for much of the cell. Each of the proteins that perform the duties required for HIV to infect and hijack cells is encoded in the nucleic acid molecules that lie in the core of each HIV virus. 5 What are the requirements for a replicable information carrier? • • • • Organize chemically distinct structures (bits) in a readable sequence Possess redundancy for error correction and faithful copying Resist degradation Be recognized by cellular machinery How does DNA satisfy these requirements? Now that we have a basic understanding of the biological role of DNA, we will devote the remainder of the lecture to revealing how the chemical features of DNA enable these molecules to serve as replicable information carriers in the cell. Let’s start by defining the requirements for replicable information carriers. First, the molecule must contain multiple possible structures at a given location and sequence in order to carry information. Second, the molecule must possess the redundancy to enable error correction and to maximize the fidelity of the replicated information. Third, the molecule must be stable over the time scale within which the information is used. Finally, the molecule must be recognized by the cellular machinery that replicates, repairs, and makes use of the information. We’ll begin our discussion of how DNA meets these requirements by examining its structural components. 6 W h a t a r e t h e c h e m ic a l d if f e r e n c e s b e t w e e n p r o t e in s a n d D N A ? HO HO H N O O N H OH H2N O OH N H O amino acid monomer p e p tid e b o n d protein polymer diversity of structure and function O NH2 O PO OH HO N O N N N H N H N O N N O N O O O O O P O O N H N CH3 H O N N O CH3 HO O O P O O O P O O primarily carries information O nucleotide monomer O P O O p h o s p h o d ie s te r b o n d nucleic acid polymer From studying for your first midterm exam I’m sure that you are all familiar with the amino acids and how they are linked into a peptide chain and form a protein. As we have seen before, tyrosine can form a polymer with alanine and serine, linked by peptide bonds. Proteins are built out of 20 different monomers while DNA is built out of four different monomers. You know how the 20 naturally occurring amino acids can contribute to the large structural diversity of proteins to allow them to accomplish their multitudes of function. Now you will see how the building blocks of DNA allow DNA to perform its biological role. Later on we will discuss how the building blocks DNA are linked together into a polymer. 7 T h e in f o r m a t io n in D N A is e n c o d e d in t h e o r d e r o f b a s e s Purines H N Four different bases are used as part of a DNA nucleotide 2 types of bases The bases of DNA are flat ring structures In double stranded DNA the bases pair Pyrimidines N H N H3C O N N H H O N H N Adenine Thymine (DNA only) O N N H N N H N H H H N H N N H Cytosine O Guanine The bases of deoxyribonucleic acid (DNA) One type of efficient information carrier encodes information based on the order in which a collection of different information-encoding “bits” exists in a string of these bits. In the case of DNA, these information-encoding bits are the four bases of DNA. The bases of DNA are planar cyclic structures containing carbon, nitrogen, oxygen, and hydrogen atoms. Rings comprising both carbon and non-carbon atoms (such as the four DNA bases) are called heterocycles. The four DNA bases are called adenine, cytosine, guanine, and thymine but are usually referred to as A, C, G, and T respectively. The two larger bases, A and G, are collectively classified as purines, while the two smaller bases, C and T, are pyrimidines. 8 D N A is a d o u b le h e lix m a d e u p o f n u c le o t id e s NH2 Phosphate O P O O N N N N Base OO O Sugar Polymer Nucleic acids are polymers of nucleotides Monomer Each nucleotide consists of a phosphate, a sugar, and a nitrogenous base The primary structure of DNA The information carrying function of DNA depends on the four different nitrogenous bases, but each base is part of a so-called nucleotide monomer that includes a deoxyribose sugar and a phosphate group. Thus, DNA is a polymer consisting of nucleotides. Each of your cells contains ~6,200,000,000 DNA nucleotides. The four bases, when connected to just a deoxyribose sugar, are called the nucleosides adenosine, cytidine, guanosine, and thymidine. As you have learned before, DNA exists in the cell as a double-stranded polymer, meaning that two chains of nucleotides are closely associated with each other. In two dimensions, you can think of double-stranded DNA as a ladder. In three dimensions, double-stranded DNA usually adopts its famous “double helix” structure. 9 ...
View Full Document

Ask a homework question - tutors are online