Lecture 10 - BIO 311 PROTEIN SRUCTURE and DETECTION METHODS Amino acids The building blocks of proteins H H H N C R NH2 = primary amine group NH2 =

Info iconThis preview shows pages 1–21. Sign up to view the full content.

View Full Document Right Arrow Icon
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
R = side chain – this is variable Amino acids The building blocks of proteins C H R N H H C O OH NH 2 = primary amine group NH 2 = primary amine group N H H COOH = carboxyl group
Background image of page 2
Peptide Bond C H R N H H C O OH C H R N H H C O OH amino acid # 1 amino acid # 2 C H R N H H C O C H R N H C O OH a peptide bond! H H 2 O O OH H
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Protein Synthesis Remember, DNA is transcribed to RNA 5’ to 3’ RNA is translated to protein from N- terminus to C-terminus 5’ to 3’ N to C Done on ribosomes with the assistance of tRNA
Background image of page 4
Genetic Code
Background image of page 5

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Enhanced Green Fluorescent Protein What does “enhanced” mean? 1. Codon usage has been switched to correspond to “human” codon-usage by creating 190 silent base changes. 2. The Kozak consensus translation initiation site has been placed in the upstream mRNA sequence. 3. Double amino acid substitutions of a red-shift variant form of GFP are used for brighter fluorescence.
Background image of page 6
Amino Acid Codon % usage in humans Anticodon in tRNA Glutamine CAG 73 % CTG Glutamine CAA 27 % UUG Q Human Codon Usage
Background image of page 7

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Protein Synthesis AAA AAG GCCGGCUGG AAGUUA TTTCGGCCGACCTTCTTCAAT Lys Ala Gly Trp Lys Lys Leu ribosome tRNA Transcription Translation DNA 5’ 3’ N C RNA Protein (polypeptide)
Background image of page 8
Levels of structure in protein architecture Primary Secondary Tertiary Quaternary
Background image of page 9

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Primary Structure Order of amino acid sequence At this point the molecule is called a polypeptide Lys Ala Gly Trp Lys Lys Leu
Background image of page 10
Background image of page 11

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Secondary Structure The spatial arrangement of amino acids 2 types of arrangements α - helix β - sheet
Background image of page 12
Bonding Between Amino Acids of a Polypeptide Chain (a) H - bonds (a) H - bonds (b)Disulfide bonds (Cys and Cys) (b)Disulfide bonds (Cys and Cys) (c) Ionic bond (Asp and Lys) (c) Ionic bond (Asp and Lys) (d) Hydrophobic bond (Val and Ile) (d) Hydrophobic bond (Val and Ile)
Background image of page 13

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Bonding Stabilizes Secondary Structure of the Alpha Helix The NH of an amino acid forms an H- bond with the CO of the amino acid 4 residues earlier
Background image of page 14
Bonding Stabilizes Secondary Structure Anti-parallel β - sheet Parallel β - sheet
Background image of page 15

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Tertiary Structure Globin fold β - barrel The 3 – D structure of the protein
Background image of page 16
Bonds Stabilize Tertiary Structure as well Hydrophobic Hydrophobic bonds bonds H-bonds Disulfide bonds Ionic bonds
Background image of page 17

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Green Fluorescent Protein (GFP) The protein has 239 amino acids The three dimensional structure was determined in 1996 Looks like a barrel with a light bulb – the fluorophore Can be detected by fluorescence of the imbedded fluorophore at amino acids 65, 66 and 67 http://www.rpc.msoe.edu/cbm2/gfp1.htm
Background image of page 18
S S Quaternary Structure of an Antibody V H C L V L C L Arrangement of multiple protein molecules in a multi-subunit complex
Background image of page 19

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
2 Different Types of Proteins Based on Structure Fibrous proteins Globular proteins
Background image of page 20
Image of page 21
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 03/28/2011 for the course BIO 311 taught by Professor Staff during the Fall '08 term at SUNY Stony Brook.

Page1 / 70

Lecture 10 - BIO 311 PROTEIN SRUCTURE and DETECTION METHODS Amino acids The building blocks of proteins H H H N C R NH2 = primary amine group NH2 =

This preview shows document pages 1 - 21. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online