2010 Bio 320 Lecture 14 + 15

2010 Bio 320 Lecture 14 + 15 - Ge tics, part 2: ne fromge...

Info iconThis preview shows pages 1–12. Sign up to view the full content.

View Full Document Right Arrow Icon
Genetics, part 2: from genotype to phenotype office: Centers for Molecular Medicine, room 447 (just over the 4th floor bridge from Life Sciences) Hours: drop by any time, or email for an appointment: [email protected] Maurice Kernan my research: uses Drosophila genetics to study mechanosensory transduction - how sound and touch are converted to electrical signals in the nervous system.
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Why I do (and teach) genetics The unifying basis for biology: the universal “logic of life”. A powerful set of tools to engineer living systems. A way to discover molecules and mechanisms in biology. An analytical technique, a way of thinking - not just a set of facts… A new type of knowledge about ourselves… A new window on our past… A transforming force in medicine, law and politics.
Background image of page 2
14-16 Basics of gene expression - getting from DNA to protein; - regulating gene expression (in bacteria) Genotype Phenotype Gene expression Gene transmission 17-19 Tools & techniques - recombinant DNA - DNA cloning & amplification - sequencing & genomics - analysing variant genotypes
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
24-26 Change, variation & complexity - population genetics, human evolution complex traits - “heritability” in humans; behavioral genetics 20-23 Gene expression in eukaryotes: - chromosomes & expression: imprinting - cell cycle regulation and cancer genetics - gene expression and development.
Background image of page 4
Proteins carry out most biochemical functions Genes control phenotype because they can encode proteins. DNA is inert - it has little biochemical activity Genotype 1 gene Phenotype 1 enzyme polypeptide
Background image of page 5

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
C NH 2 X C O N H C C O OH O C C H N Z Y Protein structure C NH 2 COOH X C NH 2 COOH Y C NH 2 COOH Z
Background image of page 6
The “sequence hypothesis”: all protein properties determined by 1 o amino-acid sequence Text fig. 7.23 Levels of polypeptide structure
Background image of page 7

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Genotype base sequence DNA base sequence RNA Phenotype amino acid sequence Protein Information flows from DNA to RNA to protein - the “Central Dogma” of molecular biology. How does it work? - a  genetic code   How did it get started?
Background image of page 8
1. How geneticists & biochemists cracked the code - clues from protein sequences and bacterial genetics - identifying the RNA message - using synthetic messages to read the code “dictionary”  2. How cells read the code -  a simplifying assumption: the “sequence hypothesis”
Background image of page 9

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Theoretically possible codes: CGATGTTACCGTAGCTGCTA… Punctuated? CGA , TGT , TAC , CGT , AGC , TGC , TA… Reading frame? CGATGTTACCGTAGCTGCTA… Overlapping?
Background image of page 10
Properties of the code: clues from proteins Many mutations change single amino acids in a polypeptide Any amino acid can be followed by any other in protein sequences. - normal and mutant hemoglobins
Background image of page 11

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Image of page 12
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 03/28/2011 for the course BIO 320 taught by Professor N/a during the Spring '08 term at SUNY Stony Brook.

Page1 / 70

2010 Bio 320 Lecture 14 + 15 - Ge tics, part 2: ne fromge...

This preview shows document pages 1 - 12. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online