LS4 - Covel Peer Learning LS 4 (Rachel Care) Week 8 Week 7...

Info iconThis preview shows pages 1–2. Sign up to view the full content.

View Full Document Right Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: Covel Peer Learning LS 4 (Rachel Care) Week 8 Week 7 Material: 1. Suppressors of nonsense mutations a. Open reading frames: How many possible ORFs extend through the sequence below? 5 CTTACAGTTTATTGATACGGAGAAGG 3 3 GAATGTCAAATAACTATGCCTCTTCC 5 b. The nonsense suppressor is a ______ gene with a mutated ____________, which recognizes the nonsense _______ __________ and places an _________ _______ there instead. c. i. A protein in E. coli is normally encoded by the following sequence: 5-AUGGUGUACGACAAGAGAUAA-3 What is the encoded amino acid sequence? (see table on last page) ii. In a certain strain of E. coli, a mutation causes the following change: 5-AUGGUGUA G GACAAGAGAUAA-3 What is the amino acid sequence in this mutant strain? iii. Later, the mutation in (ii) above is found to revert. Sequencing shows that the DNA is still in the sequence shown in (ii). How is the wild type phenotype occurring? (List all the possible ways and be clear about your directionality!) 2. lac operon basics (vocab!) operon:...
View Full Document

This note was uploaded on 03/28/2011 for the course LS 4 taught by Professor Ribaya during the Spring '08 term at UCLA.

Page1 / 4

LS4 - Covel Peer Learning LS 4 (Rachel Care) Week 8 Week 7...

This preview shows document pages 1 - 2. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online