assignment 6 - Individual: Reading Genes Refer to the...

Info iconThis preview shows pages 1–2. Sign up to view the full content.

View Full Document Right Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: Individual: Reading Genes Refer to the following nucleic acid: 5- ATGCTATCATTGACCTTGAGTTATTAA 3 1) Is this a strand of DNA or RNA? How do you know? It is DNA since there is thymine (T) not uracil (U) in the sequence 2) If DNA, what is the complementary strand? The complementary strand is 5'-TACGATAGTAACTGGAACTCAATAATT- 3' 3) If this were the coding strand of a DNA molecule, what would the mRNA sequence be? 5-UACGAUAGUAACUGGAACUCAAUAAUU-3 4) If this were the non-coding strand of a DNA molecule, what would the mRNA sequence be? 5-AUGCUAUCAUUGACCUUGAGUUAUUAA-3 5) If DNA and a base were inserted at the beginning of the 5 end of the molecule, how would that affect protein synthesis and the resultant protein? (Hint: think about the code!) 6) If DNA and the G were deleted at the asterisk, how would this affect protein synthesis and the resultant protein? (Hint: think about the code!) If a base is inserted or deleted, the reading frame of tRNA would shift one base. If it is a coding strand, If a base is inserted or deleted, the reading frame of tRNA would shift one base....
View Full Document

This note was uploaded on 04/04/2011 for the course MNG 500 taught by Professor Linkiden during the Spring '11 term at UMass (Amherst).

Page1 / 2

assignment 6 - Individual: Reading Genes Refer to the...

This preview shows document pages 1 - 2. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online