Genetic_Material - Produces 2 new strands that are each...

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
Duplication of Genetic Material Basic function of genetic material Requires accurate replication Watson and Crick noticed something in the structure It has not escaped our notice that the specific pairing we have postulated immediately suggests a possible copying mechanism for the genetic material Uses principle of Complementarity Semi conservative Semi conservative replication means that each strand is copied Produces a new complementary strand Conserves one "old" strand in new duplexes Uses the principle of complementary base pairing: depends on H-bonding patterns of bases 5' ATGCCGTTACGAATTCTGCTA 3' 3' TACGGCAATGCTTAAGACGAT 5' Basic mechanism Open up helix Copy each strand
Background image of page 1
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: Produces 2 new strands that are each hybrids of new and old strands Requirements for replication What do we need to replicate DNA??? 1.Template: DNA to copy 2.Monomers: nucleotides 3.Enzyme: DNA polymerase 4.Open helix: helicase 5.Torsional strain: topoisomerase (gyrase) 6.More as we see how process works DNA polymerase First one found in e. coli: DNA pol1 Single polypeptide chain Main polymerase from higher eukaryotes is more than 10 polypeptides All DNA polymerases: Synthesize DNA only in 5' -> 3' direction (3' elongation) Require primer (for replication, RNA) short sequence H-bonded to template Template/Primer required for synthesis...
View Full Document

This note was uploaded on 04/11/2011 for the course BIO 111 taught by Professor Dr. bos during the Winter '10 term at Purdue University-West Lafayette.

Ask a homework question - tutors are online