3_1997 - gfith W3 Molecular Biology Final Exam - spring...

Info iconThis preview shows pages 1–7. Sign up to view the full content.

View Full Document Right Arrow Icon
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Background image of page 2
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Background image of page 4
Background image of page 5

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Background image of page 6
Background image of page 7
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: gfith W3 Molecular Biology Final Exam - spring 1997 ALL EXAMS ARE DUE AT noon on MAY 10, 1997. There is no time limit on this test. You may find it easier to take this test over several days. though if you are confident in your molecular skills, you could wait until May 9. However, I predict it will take many of you a bit longer to think of all the answers (just some friendly advice). You are not allowed to use your notes, any books or journals, nor are you allowed to discuss the test with anyone until all exams are turned in at noon on MAY 10, 1997. You may use a calculator, a ruler, and graph paper if you want. The answers to the questions must be typed, though you may want to supplement your text with hand drawn figures (write neatly for any labels in your figures). -3 pts if you do not follow this direction. Please do not write your name on any page other than this cover page. Staple all your pages (INCLUDING THE TEST PAGES) together when finished with the exam. Name (please print): Write out the full pledge and sign: How long did this exam take you to complete (excluding typing)? Molecular Weight _ _ 45 mnnnunnmmunlnflm-gg3:33: 5° mumulnnunqunII—-nlnIn 55 mmunnunmnmmnunfimnlnlu mmflill‘flflmflillllI‘_-Illlll 60 "munxuuwmu-Innflmn-mm! “mmnuna-muulnn~_.-Inn 65 M"I¥fl§ll~-.fllllll*-fllIIIII “mnaxmuwuunnnnw‘n-nIn 70 m-umnunmnumunlI_m--Inu “unfillfiflflm-IIIIII_-.IIIIII flm-xxmnmm-Ilnnm-nnlnu 75 mmnlnxiflmmalIIII_-unluu 8 pts. 1) Figure 1 has taken ER and Golgi membrane microsomes and analyzed the proteins as indicated. What can you determine about the proteins examined in this experiment? 8 pts. 2) Figure 2 shows the results of 3 experiments. KB cells were analyzed at various times (in hours) post— infection (hr p.i.) with either dl753 (a deletion mutant of a particular virus that is inactive inside cells) or rec700 (wt virus), or after treatment with Epidermal Growth Factor (EGF). The 170 kDa EGF-receptor (EGF-R) was analyzed after the membranes were treated with the detergent NP—40. DME is a particular kind of tissue culture medium, serum contains EGF, and c121 is an anti—EGF—R antiserum. What can you conclude from these data? 10 pts. 3) Figure 3 is merely to illustrate the kind of data one can get when using a particular P element to clone a novel gene. In this figure, we see that a reporter gene product is detected (light spots on the black background) in the photoreceptors of the fly (and nowhere else). Use this strain of flies and the simplest method we have discussed in class to clone a gene that is expressed only in photoreceptors. You must briefly outline the steps you would need to perform in order to clone the wild-type allele of this gene. (There is more than one way to clone this gene but full credit will be given to the one method that is the most direct and requires the fewest steps. Partial credit will be given to all other methods.) 12 pts. 4) a) Calculate the molecular weight of the bands in lanes 1 and 3 of figure 4 A (the line indicates the location of the resolving gel). You must use the graph paper provided in this test in order to get full credit. b) A soluble form of CD4 (sT4) was made, as well as two shorter forms of CD4 (V1V2 and V1). The soluble form of CD4 is comprised of four domains called V1 through V4. Above each ABC lane marker is a label that indicates which CD4 construct was used in the 4 experiments (a construct expressing V1 and V2 fused together was used twice). In all “A “ lanes, an anti-CD4 antiserum was used for immunoprecipitation; in all “B” lanes, HIV gp120 was incubated with the indicated forms of CD4 and then an anti—gp120 antiserum was used for immunoprecipitation; in all “C” lanes, the anti-gp120 antiserum was used for immunoprecipitation in the absence of gp120. What can you conclude about HIV gp120 and CD4? 9 pts. 5) Figure 5 is an in situ hybridization of a fly egg before fertilization and it detects the mRN A from a single gene that is localized in the posterior end. a) Hypothesize how a maternal mRN A can be localized to a particular region of an egg. b) Design an experiment to determine how the mRN A can be localized to any discrete area of the egg. You do not need to give any volumes of reagents, just OUTLINE how you would design an experiment to determine the mechanism for an mRN A to stay in one region and not diffuse across the egg, 8 pts. 6) Beta tubulin is half of a dimer (Ct/[3 dimer) that helps form microtubules. From these immunofluorescence data, what can you conclude about the role of microtubules in organelle structure? 8 pts. 7) a) From figure 7, what can you conclude about this promoter’s response to the transcription factor RBP? (RBP3 expression is under control of the CM viral promoter in this experiment.) b) What is the obvious next experiment to do if you want to define the promoter even more? 8 pts. 8) What can you conclude from the data concerning RBP3 in figure 8? 10 pts. 9) a) What can you conclude about the location of the protein noggin ? b) What can you conclude about the subcellular location of W1 during translation and later, when W1 finally reaches its proper subcellular location? 9 pts. 10) Tell me the name of the cDNA that has the accession number M94130. What organism is it from and in what journal was the sequence first published? In case you have not memorized the email method of doing this, you may use these directions: 1) Send a message to the following address: retrieve@ncbi.nlm.nih.gov 2) Send a message that has the following format: DATALIB[space]genbank BEGIN (Enter in the accession numbers for the sequence you found in the search above. Put only one accession number per line.) Hit return twice and then send the email. 10 pts. 11) Answer the following questions about the yeast 2-hybrid system: a) What controls do you need to perform when cloning a cDNA by this method? b) List all of the parts of each plasmid used for this method. You do not need to give me the particular amino acids, just the functional domains that we discussed in class. c) Which of the two vectors/functional domains is used to make the genomic or cDNA library? (1) Where within the yeast cell must the resulting fusion proteins go? e) How are these proteins targeted to the proper subcellular location? B ‘5 S 32 a) . syntaxm 5 g“. rbet1 syntaxin6 e extract was fractionated by centrifugation gradient. and sequential ce of syntaxin 5 and rbet1 Arrows indicate the mobili- (A) Rat liver membran through a 9.9% to 31.5% glycerol velocity fractions were analyzed for the presen by electrophoresis and immunoblotting. ties of marker proteins. (B) lmmunoprecipitations were carried out as detailed in Experimen- tal Procedures, and the resulting supematants and pellets (S and P) analyzed by electrophoresis and immunoblotting. Labels along the top correspond to the antibodies used for immunopreCIpitation, while labels along the left indicate the antibodies utilized for immu- noblotting. The leftmost column labeled "extract" represents the starting membrane extract prior to addition of reagents or incuba- tions. Pellets were resuspended in one—tenth the volume of the starting extract and supernatant. Thus, quantitative precipitation would result in a pellet band 10X more intense than in the starting extract, and 1 0% efficient precipitation would result in a pellet band of roughly equal intensity to the starting extract and partially de- pleted supernatant. ‘ A 41153 hrp.i. 2 4 s 810 170———-——_ rec'IOO hr pl. m 17D—-——-— EGF (toonglml) hr after EGF 0 1 2 4 6 170—- — F. . . igure . Analy5is Olga n KB Cells following InfectiOi with dl753 or rec700, or Stimulation with EGF .—_——. (A).KB cells were pulse-labeled with L-[35S]cysteine for 1 hr followei by Incubation with M supplemented with 5% horse serum for 3 h Cells were then either infected with d/753 or rec700 in serum-fret medium, or stimulated with EGF following an additional 1 hr re incubationin serum-free medium. Cells (107) were collected at thep ir tervals indicated, and NP—40 extracts were immunoprecipitated usini c‘lg antiserum. Aten-lold excess of unlabeled L-cysteine was incl d l in all incubations after the initial pulse label. u e‘ Fi we; 5 ‘ ' ‘ ' g patial Localization of- RNAs by In Situ Hybridization to Tissue Sections of Adult Fly Heads Frozen sections of adult fly heads were hybridized to (A, B) DNA probes nick translated 3H-labeled l PS A C all l. ll ‘ . ' - ~ . r d E, b lg tlleldS' B D alld F dalk lelds l let-“a a la” . '3 gallglO '3' s "'6 "Iedu 3 0c ace bl b a H II . _ i i 1 r - e. l l l y I . ' h I I ‘ I I ages (B. D. a d , 50 E tscatte e cuticle l5 See “3| ' | f I ’ 1 I“; y I I | the dal k-l e d ll" " Ii I" II I ll ll. ppears l0 be llallsCllbed | I i A 12345 B *‘———‘— 3T4 vw2 VlV2 v: kiln KOAABCABclEueABCABc 97- " a- “3' A 68— ' 43‘ 43— " 26- 26 26— - Q. _ ~ — 18- -” 14-. Q. 14— — h 9 which can be experimentally reproduced by exposing ..-.......,.,...use cells cells to the microtubule depolymerizing drug, nocodazol Figure 6. Treatment oi Cells with Nocodazol ,,._, BHK cells were treated with 10 uM nocodazol for 4 hr prior to fixation and processing for im- munolluorescence. Staining for B-tubulin con- firmed that following treatment, the normal microtubular organization (A) had been com- pletely disrupted (B). The distribution of anti- TCP-1 — staining was .ocalized both before fl) and after (D ~ nocodazol-— A pE2wtCAT ATF EZF E2F — pE2 (-80/-70) CAT A 52F EZF pE2 (<64l—60.-45/-36) CAT W 12 10 Figure 7‘ Transcriptional Activation by RBP3 (A) Schematic organization of the reporter constructs pE2 (wt) CAT. pE2 (-80/-70) CAT. and pE2 (-64/-60.-451-36) CAT. (B) The response of the three reporters to input pCMV-RBPS plasmid has been assessed in T98G cells. These were transiently transfected in duplicate with 10 pg of either pE2 (wt) CAT. pE2 (-80/-70) CAT. or pE2 (-64l-60, 45/436) CAT; ‘ o, 0.1, 0.3. 1. 3, or 10 pg of pCMV-RBP3m (as 4 indicated)“ “. Relative CAT activity refers to unit CAT activity * 0 —o—— pE2wtCAT + pE2 (-80/—70) CAT —-r—- pE2 (cw-so, -45/-36) c, (arbitrary units) a) Relative CAT activity m* 2 W . .l _ 0 fl 0 2 4 6 a 10 Input CMV-RBPs (pg) Skeletal muscle a 3 t g «a 9 a ‘— 0 8 e 5.! c .3 35 5 I a: (L 3 _l X IL .7 9.5 kb— ‘ I 0 7.5kb- “ ’ “ a? 3 '§ = ‘ “é ' l I l l l 1; o . ‘ ,I ‘l ii I . = .. I I I 'l ' I a , e a) 8 o 50 too 150 200 250 300 350 400 450 500 550 coo Figure Northern Blot Analysis of RBP3 mRNA Isolated from new“. Number Human Tissues L A human tissue Northern bbt (Clomecn) was prehed with a 2.0 kb Nucleotide and Deduced Amino Acid Sequence of the W1 cDNA and Hydropathy Plot RBP3 cDNA probe (nucleotides 498-2517). Each lane contains- .poly(A)+ RNA from the indicated tissues. Size markers are indicated on the left in kilobases. . . . ESE . . . . . . . . 1 : MetAspHi sSeIGlnCysLeuValThrI leTyrAlaI‘uHctValPheLouGlyLeultgl leAspG].nGlyGlyCysGlnHiaTytLeuHis IleArgPrcAlaProSezGluAsnLeu 1 :ATGGATGATTCCCAGTGCCTTGTGACTATATATGCICTGATGGTCTTCTTGGGACTTAGMTAGACCMGGGGGTTGCCMCATTATCTGCACATQGACCGGCTCCTAGTGMMCCTA 4 1:PtoLeuValAspLeuI leGluHistoAsponI leTyzAspProLysGluLy5A:pLeuAsnGluThtLeuLeuAquhrLeuHeCValclyHi sPheAspProAsnPheMetAlaThr 1 2 1 : CCACTGGTGGACCTTATTGAGCACCCWTCTATGATCCCMGGAGMGGATCTTAACGAGACCTTGCTGAGGACTTTMTGGTTGGACACTTTGACCCCMCTTTATGGCCACC . . Bam HI . . . . . . . . . 81: I leLeuPtoGluGluAtheuGlyVa 1GluAspLeuGlyGluLeuAspLeuLeuLeuArgGlnLysProSerGlyAlaMetProAlaGluI leLysGlyLeuGluPheTyrGluGlyLeu 2 4 1 : ATCCTGCCAGAGGAGAGACTTGGAGTGGAGGACCTTGGGGAGTTGGATCTCCTTCTTAGGCAGMGCCCTCGGGGGCAATGCCAGCGGAMTCMGGGACTGGAGTTTTAC GAGGGGCTT 1 2 1 : GinSetLysLysl-h sAszeuSerLysLysLeuArqArgLysLeuGlnt‘lethpLeuTtpSe rGlnThrPheCysP roValLeu’l‘erhrTrpAsnAspLeuGIyThrArtheT erro 3 61 : CAGAGCMGCACAGACTGAGCMGAMCTCAGGAGMAGTTGCAGATGTGGCTCTGGTCCCAGACCTTCTGTCCTGTCCTTTACACATGGMTGACCTAGGGACCAGGTTTTGGCCT . <- 5 . 5 . . . . . . . . . . 1 6 1 :ArgTyIVa lLySVa lGlySe rCysTyrSerLysArgSe tCysSerValPtoGluGlyHecVa lesLysAlaAl aLysSerMetHisLeuThrI 1 eLeuAquprrgCysGlnAngrq 4 8 1 : CGCTATGTGAMGTAGGGAGCTGC'1'ACAGTMGAGGTCTTGTTCTGTGCCAGAGGGCATGGTTTGCAAAGCTGCCAAGTCTATGCATTTGACCATCTTMGGTGGAGATGT CMCGCAGG 2 0 1:ValGlnGlnLysCysAlaTrpI leThr I leGlnTerroVal I leSexGluCys Ly:CysSercys ‘5 60 1 : GTTCAGCAGMGTGTGCGTGGATMCCAT'l‘CAGTACCCTGTCATTTCCGAGTGCAAATGCTCATGCTGAGACT TTGGACTMTGCAAMAGACAGTAGCTTCATGGTTCWATG . . . . . . t . . . . :lxnd I I I . 'l 2 1 : TTATATGCACTGTAATATGTAGMATGTATATGTGTGTATATATGGCATTGGTCTMATTACTATTMAAGGTCAGTATTAT‘X'CTTTTAMTAACCAGTGTCTACTGTATTTCCMCACT 8 4 1 : ATTA’I‘CCTGGTTG‘I‘GTTTTATTTTMTMTATTATTATTATTTTTTTTTTGCCTMTGTATCTCTATTTATATCCAMMMGAGCACTTCGCTTGGCGAAGCATTTTTTI‘TTMAGMA 96 1 : AAAAAAACMATTTAATACTTTMTAATATAGMGCATTT’ITTTCCTTTMTGGAAMTGTGCCTTTTTTTGATGGACCTCWTGWCCAGAGCMGATATMTTT 1 0 B 1 : TCAGTTTATTGTACATAGMAGAGMCACATTTTGAMGATGMAMTTTTACTCTTGTAAATGAGMCTATCTGCTATTTATTCTTTTATTTTTTTTTTCCTCCCCCTGI‘AGAGTGCAG 1 2 D 1 2 WGTMACCACTAMATATTWAMAMM . A Figu . ucleotide Sequence of noggin cDNA and Hydropathy Plot 100 20° of Predicted noggin Polypeptide (A) Nucleotide sequence of noggin cDNA. The complete nucleotide sequence and the predicted amino acid sequence encoded by noggin cDNA are shown. A potential N-linked glycosylation site (asparagine at amino acid number 61) is indicated by an asterisk. Potential polyade- nylation sequences (AATAAA) are underlined. The 3’ end of exo- nuclease clone 5.5. which was used as a template for RNAase protec- tion assay, is underlined. « Hydropathy plot of predicted noggin polypeptide. The hydropathy of predicted noggin polypeptide was plotted by the method of Kyte and Doolittle (1982). kuJ Hydrophoblclty .L o I u N \ 100 zoo Amino Acid Number ...
View Full Document

Page1 / 7

3_1997 - gfith W3 Molecular Biology Final Exam - spring...

This preview shows document pages 1 - 7. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online