Group_Activity_-_Hawaian_Island_Scenario

Group_Activity_-_Hawaian_Island_Scenario - B C D BPs 30 25...

Info iconThis preview shows pages 1–2. Sign up to view the full content.

View Full Document Right Arrow Icon
ISB 201L Name _________________________________ Below are three single strands of DNA taken from blow fly specimens from each of the three Hawaiian blow fly populations (A, B, and C) A - CTATTAGTAGTCCTAACTAACTAGGATAGA B - TCAGGTCATACCTAGCTTATCCTAGCCTAGT C - GGTAGCCATACCTACACATTACATATAGACC 1. For each sample, indicate where cuts would be produced if a restriction enzyme were applied to each DNA sample that recognized and cut directly after the sequence TAG. 2. What would the sequence of the first five bases of the complimentary strand of DNA be for sample C? 3. In the spaces provided on the gel below, identify the relative distances that the resulting fragments would travel for each sample. The DNA from the blow flies that were found on the floating body (D) matches one of your suspects and has been drawn for your reference. A
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Background image of page 2
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: B C D BPs 30 25 20 15 10 5 4. The DNA from which island population best matches the DNA collected on the victim? 5. If there had been a suspect identified from that island, would this evidence be sufficient to convict that person of the crime committed? Explain your answer. Post Lab Questions 1. Clearly explain how the technique of Gel Electrophoresis can help to distinguish between two different people or two different populations of organisms. In your answer be sure to describe how the structure of DNA is important in this process. 2. Clearly explain what is a GMO? (besides being a Genetically Modified Organism) 3. What allowed us to determine whether one kernel of corn had come from a GMO plant or not? 4. What problem exists with always being able to successfully identify a GMO plant in this way?...
View Full Document

Page1 / 2

Group_Activity_-_Hawaian_Island_Scenario - B C D BPs 30 25...

This preview shows document pages 1 - 2. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online