Tutorial #2 - Biology 1M03 TUTORIAL 3| PHYLOGENETIC TREES...

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: Biology 1M03 TUTORIAL 3| PHYLOGENETIC TREES Student Package Objectives ! Be able to use morphological and molecular information to construct phylogenetic trees ! Be able to discuss the advantages and disadvantages of various methods for creating phylogenetic trees Preparation ! Read the Introduction in this lab manual ! Read pages 543‐548 from Biological Science: 3rd Edition, by Scott Freeman ! Read Bioskills 2 in the Bioskills section in the back or Biological Science: 3rd Edition, by Scott Freeman ! View the pre‐lab ELM powerpoint lesson ! Complete the ELM pre‐lab quiz ! Fill in the sheet entitled ‘Caminalcule Morphology: Similarities and Differences INTRODUCTION : Evolutionary theory postulates that organisms on earth are related by common ancestry, which inevitably results in species with common characteristics. The evolutionary history of a group of organisms is known as a phylogeny and can be illustrated in the form of a phylogenetic tree. This is a means of depicting ancestor‐descendant relationships and who is related who (Freeman, 3rd edition section 27.1). The cladistic approach to deriving phylogentic trees is based on identifying shared, derived characteristics (or synapomorphies) in the species being studied. Morphological traits that consist of the shape and appearance of an organism’s body and counterparts, is one method of identifying derived characteristics that can then be used to create a phylogenetic tree to relate the species. This method relies on accurate observation and determines visible differences between the species. Observable changes in morphology are the end result of changes happening at the gene level. Mutations in DNA can result in changes in the function of the encoded protein which can then bring about changes at the cellular and morphological level. With the advent of techniques that allow rapid sequencing of the DNA of many organisms, changes in the DNA sequence of a particular gene or conserved region of DNA can also be used to derive phylogenetic trees. In addition, the use of DNA sequences as the basis for determining phylogenies also allows the determination of “genetic distance” between the different species. This is a measurement of the average percentage of bases in a particular DNA sequence that differs between two species. Bioinformatics involves the use of mathematical and statistical based computer programs to analyze the vast amount of data being generated by these new molecular based techniques. Different computer programs, many of which are available as web sites, are utilized to compare, align and interpret DNA sequence data in the modern study of molecular evolution. 1 PRE‐TUTORIAL ASSIGNMENT In lecture you will have discussed phylogenetic trees (Freeman, 3rd edition section 27.1), for a review of the terminology watch the PowerPoint presentation entitled “Phylogenetic Trees: PowerPoint Lesson”. The fictional organisms called Caminalcules (Sokal, 1983) will be used as model organisms to derive phylogentic trees based on morphological traits. Fill in the sheet entitled ‘Caminalcule Morphology: Similarities and Differences’ by listing characteristics unique to each creature and also some that are shared between the two, before attending lab. Complete the pre‐lab ELM quiz which contains information about creating and interpreting phylogenetic trees. IN‐CLASS ACTIVITY The TA will give a brief overview of how to draw a phlyogenetic tree based on the information in the table on page 4. You will then be shown how to analyze the different Caminalcule species based on morphological traits by means of a PowerPoint presentation and discussion in the class. In groups of 4 you will then use this information to complete the table of traits (page 6) and draw a phylogenetic tree to relate the 5 Caminalcule species (use page 7). Each member of the group must draw the tree as it will be handed in with your post‐lab assignment, it will be needed to answer the post‐lab assignment questions. The second part of the lab will discuss the use of molecular data in the form of DNA sequences. How sequences can be used and why computers are the preferred means of analysis will be demonstrated with the DNA Alignment exercise (page 8). POST‐TUTORIAL ASSIGNMENT This assignment is to be done individually. The DNA sequences listed on page 10 correspond to a hypothetical conserved gene present in the 5 Caminalcule species. Using the online tool TreeTop Phylogenetic Tree Prediction you will create a phylogenetic tree based on the molecular data. The link for TreeTop Phylogenetic Tree is http://www.genebee.msu.su/services/phtree_reduced.html To use this program, you must copy the sequences as they appear below, and paste them into the box that appears below the word “Alignment”. Under “Tree and Picture Options”, ensure that you have selected “Phylip”, “Slanted” and “No” to bootstrapping . Click “Submit Query”. 2 The program may take a few minutes to create your tree. To view your tree, scroll down to the very bottom of the screen and place the mouse over “Topological Algorithm: Slanted”. Copy and paste your tree into a Word Document, and answer the questions in the post‐lab assignment . TreeTop also provides additional information on the genetic relationships of the organisms. Use the section entitled “Distance Matrix” to answer the relevant questions. You will be handing in: TreeTop generated phylogenetic tree Morphological tree drawn in class (for comparison) Post‐lab assignment sheet Make sure your name and student number is on each page you are handing in! References Sokal, R.R. (1983) A Phylogenetic Analysis of the Caminalcules. I. The Data Base. Systematic Zoology, 32(2):159‐184. 3 PRE‐TUTORIAL ASSIGNMENT: COMPARING CAMINALICULE MORPHOLOGY These are two “species” of Caminalcules, a group of fictional organisms whose evolutionary relationship has been established by researchers who study evolutionary biology (Sokal 1983). Make a list of the traits that are similar and different between the two examples C. toha (Differences) Similarities C. fiftia (Differences) 4 IN‐CLASS ACTIVITY: CONSTRUCTING A PHYLOGENETIC TREE Use this page to follow along during the lab presentation. This is for information only, do not hand it in. Species Amnion Legs Character Trait Warm Blood Hemipenes Gizzard Vertebrate Snake Gecko Frog Alligator Bird 1 1 0 1 1 0 1 1 1 1 0 0 0 0 1 1 1 0 0 0 0 0 0 1 1 1 1 1 1 1 Draw your tree in the space below: 5 CAMINALCULE IMAGES AND SPECIES NAMES 6 CONSTRUCTING A PHYLOGENETIC TREE: ASSESSING MORPHOLOGICAL TRAITS Caminalicule Trait Chart Look at the pictures of the caminalcules and identify the traits that are important in distinguishing each species. If the caminalicule has the trait, write a ‘1’, and if they do not have the trait write ‘0’ Fill in this table, including the missing numbers and traits. Species c.twintion c.fiftia c.atein c.sixia c.fortion Front appendages 0 1 0 1 1 1 Bifurcated (forked) tail 0 Traits Curled arm appendage 0 Black squares on Elbows and back bent arms 0 0 Front Feet/Toes 0 After completing this table, complete the following page by creating the corresponding phylogenetic tree. Make sure to identify the origin of the traits and label all the species locations found on the tree (on the end of branches). 7 CONSTRUCTING A PHYLOGENETIC TREE USING MORPHOLOGICAL CHARACTERISTICS Name: _________________________________________________Student number: ______________________ Phylogenetic Tree: Caminalcules Draw your tree in the space provided. Clearly label traits and species names in their corresponding locations. Be sure to create the most parsimonious solution. 8 IN‐CLASS ASSIGNMENT: BIOINFORMATICS & MOLECULAR PHYLOGENIES DNA ALIGNMENT GROUP EXERCISE The following DNA sequences are taken from closely related organisms (L. gofficus , J. dushoffi, L. kajiuricus and A. cowiensi). The DNA encodes a highly conserved enzyme that is responsible for a basic cellular process. Any shared differences in the genetic codes are thus likely to correspond to more closely related organisms. In groups of 4: examine the DNA sequences and compare the difference between organisms. Which appear to be more closely related? How would you draw a phylogenetic tree for these organisms? NOTE: Assume L. gofficus is an outgroup based on previous evidence. L.gofficus J.dushoffi L.kajiuricus A.cowiensi L.gofficus J.dushoffi L.kajiuricus A.cowiensi L.gofficus J.dushoffi L.kajiuricus A.cowiensi L.gofficus J.dushoffi L.kajiuricus A.cowiensi L.gofficus J.dushoffi L.kajiuricus A.cowiensi L.gofficus J.dushoffi L.kajiuricus A.cowiensi L.gofficus J.dushoffi L.kajiuricus A.cowiensi GCTACGTATCGATGCATCGATGCATGCATGCATGCATGCGCGTATGCGTAGCGCGCGATATCGCGATTCG GCTACGTATCGATGCATCGATGCATGCATGCATGCATGCGCGTATGCGTAGCGAGCGATATCGCGATTCG GCTACGTATCGATGCATCGATGCATGCATGCATGCATGCGCGTATGCGTAGCGCGCGATATCGCGATTCG GCTACGTATCGATGCATCGATGCATGCATGCATGCATGCGCGTATGCGTAGCGCGCGATATCGCGATTCG 70 GCGCTATATACGCGCTATAGCTCGATCGATCGCTAGCTAGCTAGCTCGATCGATCGATTAGCGATCGGCTA GCGCTATATACGCGCTATAGCTCGATCGATCGCTAGCTAGCTACCTCGATCGATCGATTAGCGATCGGCTA GCGCTATATACGCGCTATAGCTCGATCGATCGCTAGCTAGCTACCTCGATCGATCGATTAGCGATCGGCTA GCGCTATATACGCGCTATAGCTCGATCGATCGCTAGCTAGCTAGCTCGATCGATCGATTAGCGATCGGCTA 210 ATATCGCTAGCTAGCTCGGCTATATTAAGAGCTCTATAGATCTCTCTAGAGCTCGATCGATAGCTATATAG ATAACGCTAGCTAGCTCGGCTATATTAAGAGCTCGATAGATCTCTCTAGAGCTCGATCGATAGCTATATAG ATAACGCTAGCTAGCTCGGCTATATTAAGAGCTCGATAGATCTCTCTAGAGCTCGATCGATAGCTATATAG ATAACGCTAGCTAGCTCGGCTATATTAAGAGCTCGATAGATCTCTCTAGAGCTCGATCGATAGCTATATAG GCGGATTATGCGCTAAAGCGCTAGCATCGGCTAAGCGTAATGCATGGAATCGGATACGATTAGCTATCGT GCGGATTATGCGCTAAAGCGCTAGCATCGGCTAAGCGTAATGCATGGGATCGGATACGATTAGCTATCGT GCGGATTATGCGCTAAAGCGCTAGCATCGGCTAAGCGTAATGCATGGGATCGGATACGATTAGCTATCGT GCGGATTATGCGCTAAAGCGCTAGCATCGGCTAAGCGTAATGCATGGAATCGGATACGATTAGCTATCGT 450 TATAGCTAGCTAGCTAGCTATATCGCGCTCTGTCGATATCGCGATAGCTAGCTAGATCGATCGATCGCGAT TATAGCTAGCTAGCTAGCTATATCGCGCTCTGTCGATATCGCGATAGCTAGCTAGATCGATCGATCGCGAT TATAGCTAGCTAGCTAGCTATATCGCGCTCTGTCGATATCGCGATAGCTAGCTAGATCGATCGATCGCGAT TATAGCTAGCTAGCTAGCTATATCGCGCTCTGTCGATATCGCGATAGCTAGCTAGATCGATCGATCGCGAT CCGCTATACCCGCGCTATAGCTCGATCGATCGCTAGCTAGCTAGCTCGATCGATCGATTAGCGATCGGCTA CCGCTATACCCGCGCTATAGCTCGATCGATCGCTAGCTAGCTAGCTCGATCGATCGATTAGCGATCGGCTA CCGCTATACCCGCGCTATAGCTCGATCGATCGCTAGCTAGCTAGCTCGATCGATCGATTAGCGATCGGCTA GCGCTATACCCGCGCTATAGCTCGATCGATCGCTAGCTAGCTAGCTCGATCGATCGATTAGCGATCGGCTA 590 AAAAGCTAGCTAGCTAGCTATATCGCGCTCTGTCGATATCGCGATAGCTAGCTAGATCGATCGATCGCGAT AAAAGCTAGCTAGCTAGCTATATCGCGCTCTGTCGATATCGCAATAGCTAGCTAGATCGATCGATCGCGAT AAAAGCTAGCTAGCTAGCTATATCGCGCTCTGTCGATATCGCAATAGCTAGCTAGATCGATCGATCGCGAT AAAAGCTAGCTAGCTAGCTATATCGCGCTCTGTCGATATCGCAATAGCTAGCTAGATCGATCGATCGCGAT 9 L.gofficus J.dushoffi L.kajiuricus A.cowiensi L.gofficus J.dushoffi L.kajiuricus A.cowiensi L.gofficus J.dushoffi L.kajiuricus A.cowiensi L.gofficus J.dushoffi L.kajiuricus A.cowiensi ACACCGTATCGATGCATCGATGCATGCATGCATGCATGCGCGTATGCGTAGCGCGCGATATCGCGATTCG ACAACGTATCGATGCATCGATGCATGCATGCATGCATGCGCGTATGCGTACCGCGCGATATCGCGATTCG ACAACGTATCGATGCATCGATGCATGCATGCATGCATGCGCGTATGCGTACCGCGCGATATCGCGATTCG ACACCGTATCGATGCATCGATGCATGCATGCATGCATGCGCGTATGCGTAGCGCGCGATATCGCGATTCG TCGGATCCCGCGCTAAAGCGCTAGCATCGGCTAAGCGTAATGCATGGAATCGGATACGATTAGCTATCGT TCCGATCCCGCGCTAAAGCGCTAGCATCGGCTAAGCGTAATGCATGGAATCGGATACGATTAGCTATCGT TCCGATCCCGCGCTAAAGCGCTAGCATCGGCTAAACGTAATGCATGGAATCGGATACGATTAGCTATCGT TCCGATCCCGCGCTAAAGCGCTAGCATCGGCTAAGCGTAATGCATGGTATCGGATACGATTAGCTATCGT 740 GCTACGTATCGATGCATCGATGCATGCATGCATGCATGCGCGTATGCGTAGCGCGCGATATCGCGATTCG GCTACGTATCGATGCATCGATGCATGCATGCATGCATGCGCGTATGCGTAGCGCGCGATATCGCGATTCG GCTACGTATCGATGCATCGATGCATGCATGCATGCATGCGCGTATGCGTAGCGCGCGATATCGCGATTCG GCTACGTATCGATGCATGGATGCATGCATGCATGCATGCGCGTATGCGTAGCGCGCGATATCGCGATTCG 980 ACCCCGTATCGATGCATCGATGCATGCATGCATGCAAGCGCGTATGCGTAGCGCGCGATATCGCGATTCG ACCCCGTATCGATGCATCGATGCATGCATGCATGCATGCGCGTATGCGTAGCGCGCGATATCGCGATTCG ACCCCGTATCGATGCATCGATGCATGCATGCATGCATGCGCGTATGCGTAGCGCGCGATATCGCGATTCG ACCCCGTATCGATGCATCGATGCATGCATGCATGCATGCGCGTATGCGTAGCGCGCGATTTCGCGATTCG Observations: Therefore, the following relationships are probable: Possible phylogenetic tree: 10 POST‐TUTORIAL ASSIGNMENT: CREATING A TREE USING TREETOP The following DNA sequences encode a hypothetical highly conserved gene present in all caminalicules. Copy and paste these sequences into TreeTop and follow the instructions for creating a tree found on p.2‐3 of this manual. Then answer the questions on the following page (p.12). >Cfiftia GATCG CGCGC CCGGA GGATC CGCGC AGAGG GGGGA TTATA TTTTT AAGAG AGCGG TTATA AGCTC GATCG CGCGC CCTTA GGATC CGCGC AGAGG GGGGA TTATA TTTTT AAGAG AGCGG TTATA AGCGC >Catein CCTCG GGCGC CCCGA GGATC CGCGC AGATT GCGGA TTATA ATTTT AAGAG AGCGG TTATA AGCTT CCTCG CGCGC CCGGA GGATC CGCGC AGATT GCGGA TTATA ATTTA AAGAG AGCGG TTATA AGCTT >Csixia GATCG GGCGC CCGGA GGATC CGCGC AGAGG GCGGA TTATA TTTTT ACCCG AGCGG CCATA AGCTT GATCG CGCGC CCGGA GGATC CGCGC AGAGG GCGGA TTATA TTTTA ACCCG AGCGG TTATA AGCTT >Ctwintion GATCG GGCGC CCGGA GGATC AGCGC AGAGG GCGGA TTATA TTTTT ACCCG AGCGG CCATA AGCTT GATCG CGCGC CCGGA GGATC AGCGC AGAGG GCGGA TTATA TTTTA ACCCG AGCGG TTATA AGCTT >Cfortion CCTCG GGCGC CTCGA GGATC CGCGC AGATT GCGGA TTATA ATTTT AAGAG AGGGG TTATA AGCTT CCTCG CGCGG CCGGA CCATC CGCGC AGATT GCGGA TTATA ATTTA AAGAG AGCGG TTATA AGCTT **Note: TreeTop requires you to name each sequence by using the “>” followed by the name, without spaces or periods. The organism names are modified here to fit the syntax required by the program** 11 TUTORIAL 3: POST‐TUTORIAL QUESTIONS Name:________________________________________ Student #:_____________________ Tutorial Section: __ ___ TA:________________________ ___ " I have attached a copy of the caminalicules phylogenetic tree I created in lab (1 mark) " I have attached a copy of the caminalicules phylogenetic tree I created using TreeTop (1 mark) 1. Compare the tree you created using TreeTop to the one you drew using morphological characteristics last lab. Are the two trees equivalent? Recall that equivalent trees may look very different. (1 mark). 2. Describe where the trees differ, OR, if they are equivalent, show (on your attached phylogenetic tree) which nodes on your DNA‐based tree must be rotated to match the morphological‐trait‐based tree. (1 mark) 3. Which tree do you think is more accurate and why? (1 mark) 4. The Distance Matrix compares two organisms and indicates the proportion of DNA that differs between them. Each organism listed in the left column is compared to all other organisms by reading across a row. For example, C. fiftia has 0.248 difference from C. fortion (listed as #5. Using the Distance Matrix, answer the following questions. For each question, indicate the proportion of divergence between the organisms. a. What does a higher number, like 0.248, represent, compared to a lower number, like 0.052? Be sure your answer discusses genetic distance and relatedness. (1 mark) b. Which organism(s) is/are most distantly related to C. fiftia? (1 mark) c. Which organism(s) is/are most closely related to C. fortion? (1 mark) d. Which organisms are the closest relatives to each other? (HINT there may be more than one pair) (1 mark). 5. Your textbook discusses two approaches to creating phylogenetic trees, phenetic and cladistic. Based on your knowledge of how TreeTop creates a phylogenetic tree, which of the two approaches would you say was used by the software to create your phylogenetic tree? (1 mark) Total /10 12 POST‐TUTORIAL TASKS 1. Using TreeTop, complete the Post‐Tutorial Assignment found on p. 11 of this manual. 2. Answer the Post‐Tutorial Questions that are found on p. 12 of the manual. 3. Submit copies of the caminalicules phylogenetic trees you created both in‐class and using TreeTop. 13 ...
View Full Document

Ask a homework question - tutors are online