gene_prediction

gene_prediction - University of North Texas Biocomputing...

Info iconThis preview shows pages 1–9. Sign up to view the full content.

View Full Document Right Arrow Icon
University of North Texas Biocomputing Gene Prediction: Statistical Approaches Source: www.bioalgorithms.info
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
University of North Texas Biocomputing Gene : A sequence of nucleotides coding for protein Gene Prediction Problem : Determine the beginning and end positions of genes in a genome Gene Prediction: Computational Challenge
Background image of page 2
University of North Texas Biocomputing Gene Prediction: Computational Challenge aatgcatgcggctatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgct aatgcatgcggctatgcaagctgggatccgatgactatgctaagctgggatccgatgacaatgcatgcggc tatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggctatg ctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctgggatccgatgac aatgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctat gctaatgcatgcggctat gctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctat gcaagctgggatcctgcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatccg atgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctatg ctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcat gcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaag ctcatgcggctatgctaagctgggaatgcatgcggctatgctaa gctgggatccgatgacaatgcatgcgg ctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatg cggctatgctaagctcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatccgat gacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctatgct aagctgggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgc ggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctc atgcgg Gene!
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
University of North Texas Biocomputing Protein RNA DNA transcription translation CCTGAGCCAACTATTGATGAA P E P T I D E CCU GAG CCA ACU AUU GAU GAA Central Dogma: DNA -> RNA -> Protein
Background image of page 4
University of North Texas Biocomputing In 1961 Sydney Brenner and Francis Crick discovered frameshift mutations Systematically deleted nucleotides from DNA Single and double deletions dramatically altered protein product Effects of triple deletions were minor Conclusion : every triplet of nucleotides, each codon , codes for exactly one amino acid in a protein Codons
Background image of page 5

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
University of North Texas Biocomputing In the following string     THE SLY FOX AND THE SHY DOG Delete 1, 2, and 3 nucleotifes after the first ‘S’: THE SYF OXA NDT HES HYD OG THE SFO XAN DTH ESH YDO G THE SOX AND THE SHY DOG Which of the above makes the most sense? The Sly Fox
Background image of page 6
University of North Texas Biocomputing Codon: 3 consecutive nucleotides = 64 possible codons Genetic code is degenerative and redundant Includes start and stop codons An amino acid may be coded by more than one codon Translating Nucleotides into Amino Acids
Background image of page 7

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
University of North Texas Biocomputing Exons and Introns In eukaryotes, the gene is a combination of coding segments ( exons ) that are interrupted by non-coding segments ( introns ) This makes computational gene prediction in eukaryotes even more difficult Prokaryotes don’t have introns - Genes in prokaryotes are continuous
Background image of page 8
Image of page 9
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 04/15/2011 for the course BIOL 1132 taught by Professor Gretabolin during the Spring '11 term at North Texas.

Page1 / 57

gene_prediction - University of North Texas Biocomputing...

This preview shows document pages 1 - 9. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online