gene_prediction

gene_prediction - University of North Texas Biocomputing...

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
University of North Texas Biocomputing 1 University of North Texas Biocomputing Gene Prediction: Statistical Approaches Source: www.bioalgorithms.info University of North Texas Biocomputing • Gene : A sequence of nucleotides coding for protein • Gene Prediction Problem : Determine the beginning and end positions of genes in a genome Gene Prediction: Computational Challenge University of North Texas Biocomputing Gene Prediction: Computational Challenge aatgcatgcggctatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgct aatgcatgcggctatgcaagctgggatccgatgactatgctaagctgggatccgatgacaatgcatgcggc tatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggctatgc taatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctgggatccgatgacaa tgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgc taatgcatgcggctat gctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctatgc aagctgggatcctgcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatccgatg acaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctatgcta agctgggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcg gctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctcat gcggctatgctaagctgggaatgcatgcggctatgctaa gctgggatccgatgacaatgcatgcggctatg ctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggct atgctaagctcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatccgatgacaat gcatgcggctatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctg ggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggctat gcaagctgggatccgatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctcatgcgg Gene! University of North Texas Biocomputing Protein RNA DNA transcription translation CCTGAGCCAACTATTGATGAA P E P T I D E CCU GAG CCA ACU AUU GAU GAA Central Dogma: DNA -> RNA -> Protein University of North Texas Biocomputing • In 1961 Sydney Brenner and Francis Crick discovered frameshift mutations • Systematically deleted nucleotides from DNA – Single and double deletions dramatically altered protein product – Effects of triple deletions were minor – Conclusion : every triplet of nucleotides, each codon , codes for exactly one amino acid in a protein Codons University of North Texas Biocomputing • In the following string THE SLY FOX AND THE SHY DOG • Delete 1, 2, and 3 nucleotifes after the first ‘S’: THE SYF OXA NDT HES HYD OG THE SFO XAN DTH ESH YDO G THE SOX AND THE SHY DOG • Which of the above makes the most sense? The Sly Fox
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
University of North Texas Biocomputing 2 University of North Texas Biocomputing • Codon: 3 consecutive nucleotides •4 3 = 64 possible codons • Genetic code is degenerative and redundant – Includes start and stop codons – An amino acid may be coded by more than one codon Translating Nucleotides into Amino Acids University of North Texas Biocomputing Exons and Introns • In eukaryotes, the gene is a combination of coding segments ( exons ) that are interrupted by non-coding segments ( introns )
Background image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 04/15/2011 for the course BIOL 1130 taught by Professor Roberts during the Spring '08 term at North Texas.

Page1 / 10

gene_prediction - University of North Texas Biocomputing...

This preview shows document pages 1 - 3. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online