motif - University of North Texas Biocomputing 1...

Info iconThis preview shows pages 1–2. Sign up to view the full content.

View Full Document Right Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: University of North Texas Biocomputing 1 Biocomputing University of North Texas Finding Regulatory Motifs in DNA Sequences Source: www.bioalgorithms.info An Introduction to Bioinformatics Algorithms www.bioalgorithms.info Random Sample atgaccgggatactgataccgtatttggcctaggcgtacacattagataaacgtatgaagtacgttagactcggcgccgccg acccctattttttgagcagatttagtgacctggaaaaaaaatttgagtacaaaacttttccgaatactgggcataaggtaca tgagtatccctgggatgacttttgggaacactatagtgctctcccgatttttgaatatgtaggatcattcgccagggtccga gctgagaattggatgaccttgtaagtgttttccacgcaatcgcgaaccaacgcggacccaaaggcaagaccgataaaggaga tcccttttgcggtaatgtgccgggaggctggttacgtagggaagccctaacggacttaatggcccacttagtccacttatag gtcaatcatgttcttgtgaatggatttttaactgagggcatagaccgcttggcgcacccaaattcagtgtgggcgagcgcaa cggttttggcccttgttagaggcccccgtactgatggaaactttcaattatgagagagctaatctatcgcgtgcgtgttcat aacttgagttggtttcgaaaatgctctggggcacatacaagaggagtcttccttatcagttaatgctgtatgacactatgta ttggcccattggctaaaagcccaacttgacaaatggaagatagaatccttgcatttcaacgtatgccgaaccgaaagggaag ctggtgagcaacgacagattcttacgtgcattagctcgcttccggggatctaatagcacgaagcttctgggtactgatagca An Introduction to Bioinformatics Algorithms www.bioalgorithms.info Implanting Motif AAAAAAAGGGGGGG atgaccgggatactgat AAAAAAAAGGGGGGG ggcgtacacattagataaacgtatgaagtacgttagactcggcgccgccg acccctattttttgagcagatttagtgacctggaaaaaaaatttgagtacaaaacttttccgaata AAAAAAAAGGGGGGG a tgagtatccctgggatgactt AAAAAAAAGGGGGGG tgctctcccgatttttgaatatgtaggatcattcgccagggtccga gctgagaattggatg AAAAAAAAGGGGGGG tccacgcaatcgcgaaccaacgcggacccaaaggcaagaccgataaaggaga tcccttttgcggtaatgtgccgggaggctggttacgtagggaagccctaacggacttaat AAAAAAAAGGGGGGG cttatag gtcaatcatgttcttgtgaatggattt AAAAAAAAGGGGGGG gaccgcttggcgcacccaaattcagtgtgggcgagcgcaa cggttttggcccttgttagaggcccccgt AAAAAAAAGGGGGGG caattatgagagagctaatctatcgcgtgcgtgttcat aacttgagtt AAAAAAAAGGGGGGG ctggggcacatacaagaggagtcttccttatcagttaatgctgtatgacactatgta ttggcccattggctaaaagcccaacttgacaaatggaagatagaatccttgcat AAAAAAAAGGGGGGG accgaaagggaag ctggtgagcaacgacagattcttacgtgcattagctcgcttccggggatctaatagcacgaagctt AAAAAAAAGGGGGGG a An Introduction to Bioinformatics Algorithms www.bioalgorithms.info Where is the Implanted Motif? atgaccgggatactgataaaaaaaagggggggggcgtacacattagataaacgtatgaagtacgttagactcggcgccgccg acccctattttttgagcagatttagtgacctggaaaaaaaatttgagtacaaaacttttccgaataaaaaaaaaggggggga tgagtatccctgggatgacttaaaaaaaagggggggtgctctcccgatttttgaatatgtaggatcattcgccagggtccga gctgagaattggatgaaaaaaaagggggggtccacgcaatcgcgaaccaacgcggacccaaaggcaagaccgataaaggaga tcccttttgcggtaatgtgccgggaggctggttacgtagggaagccctaacggacttaataaaaaaaagggggggcttatag gtcaatcatgttcttgtgaatggatttaaaaaaaaggggggggaccgcttggcgcacccaaattcagtgtgggcgagcgcaa cggttttggcccttgttagaggcccccgtaaaaaaaagggggggcaattatgagagagctaatctatcgcgtgcgtgttcat aacttgagttaaaaaaaagggggggctggggcacatacaagaggagtcttccttatcagttaatgctgtatgacactatgta ttggcccattggctaaaagcccaacttgacaaatggaagatagaatccttgcataaaaaaaagggggggaccgaaagggaag ctggtgagcaacgacagattcttacgtgcattagctcgcttccggggatctaatagcacgaagcttaaaaaaaaggggggga An Introduction to Bioinformatics Algorithms www.bioalgorithms.infowww....
View Full Document

This note was uploaded on 04/15/2011 for the course BIOL 1130 taught by Professor Roberts during the Spring '08 term at North Texas.

Page1 / 11

motif - University of North Texas Biocomputing 1...

This preview shows document pages 1 - 2. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online