Molecular Biology - Biology 100 Human Biology The Molecular...

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: Biology 100 Human Biology The Molecular Basis for Inheritance Inheritance Biology 100 Human Biology Some Important Early Conclusions Regarding Inheritance Inheritance The permanence of The chromosomes, their specieschromosomes, specific nature, and their genemimicking behavior suggested mimicking that chromosomes were the units of inheritance in cells. of Biology 100 Human Biology Some Important Early Conclusions Regarding Inheritance Inheritance The underlying mechanism for The inheritance involved chemicals. chemicals Biology 100 Human Biology Some Important Early Conclusions Regarding Inheritance Inheritance Chromosomes were composed of Chromosomes nucleic acids and proteins, therefore the genetic code was preserved in either of these chemicals. chemicals. Biology 100 Biology Human Biology Nucleotide Structure Biology 100 Human Biology Polymerization of Nucleotides Nucleotides Biology 100 Human Biology Nucleic Acid, Nucleic a Polynucleotide Polynucleotide Biology 100 Biology Human Biology Chargaff’s Rule Rule q In In DNA, the amount of adenine is the same as the amount of thymine. thymine. q The amount of cytosine is the The same as the amount of guanine. guanine. q Ratio of adenine to cytosine Ratio Double Biology 100 Human Biology Stranded DNA Stranded Biology 100 Base Pairing Human Biology in DNA in ADENINE (A) THYMINE (T) Biology 100 Human Biology Base Pairing in DNA in GUANINE (G) CYTOSINE (C) Biology 100 Human Biology The The Double Helix Biology 100 Human Biology The The Double Helix Biology 100 Human Biology DNA Replication Replication Biology 100 Human Biology DNA Replicatio Replicatio n Biology 100 Biology Human Biology DNA DNA Replicatio Replicatio n Biology 100 Biology Human Biology DNA DNA Replicatio Replicatio n Biology 100 Human Biology Gene Expression Expression DNA (genetic code) Polypeptide or Protein (linear sequence of amino acids) Biology 100 Human Biology Polypeptides and Proteins Polypeptides Molecules composed of linear Molecules arrangements of amino acids. It is the sequence of these amino acids that determines the properties of a particular polypeptide or protein. polypeptide Biology 100 Human Biology Two Different Polypeptides Polypeptides GLY SER ALA TYR ILE MET LEU GLN ASP ASN ILE GLN GLY SER GLU HIS Biology 100 Human Biology Transcription Gene Expression Expression Translation Biology 100 Human Biology RN RN A Biology 100 Contrasting Human Biology RNA with DNA RNA RNA RNA q Single- DNA q Double- stranded q Ribose q Bases Adenine Uracil Guanine Cytosine stranded q Deoxyribose q Bases Adenine Thymine Guanine Cytosine Cytosine Three Kinds of RNA Three 1. mRNA (Messenger RNA) 2. rRNA (Ribosomal RNA) 3. tRNA (Transfer RNA) mRNA mRNA An RNA molecule whose An nucleotide base sequence reflects that of a gene that specifies the amino acid sequence of a polypeptide or protein. protein. rRNA rRNA An RNA molecule that makes An up the structure of a ribosome. Ribosomes translate the code of a mRNA molecule into the amino acid sequence of a polypeptide or protein. polypeptide Ribosome Ribosome tRNA tRNA An RNA molecule that carries An individual amino acids to the ribosome-mRNA complex. The amino acid is then attached to the end of a growing polypeptide or protein chain. polypeptide Biology 100 Human Biology tRN tRN A anticodon Transcriptio Transcriptio n DNA Sens e Stran d mRNA Transcrip t Base Biology 100 Pairing in Human Biology DNA DNA Base Biology 100 Pairing in Human Biology RNA RNA Biology 100 Human Biology Transcription Transcription DNA Sense Strand mRNA Transcript Transcription Transcription Translatio Translatio Biology 100 n Human Biology Amino Acid Ribosome tRNA mRNA Codon Anticodon Biology 100 Human Biology Translatio Translatio n Biology 100 Human Biology Translatio Translatio n Biology 100 Human Biology Translatio Translatio n Biology 100 Human Biology Translatio Translatio n Biology 100 Human Biology Translatio Translatio n Biology 100 Human Biology Translatio Translatio n CCAAGACGAATGTAGTACGATGTC GGUUCUGCUUACAUCAUGCUACAG GLY SER ALA TYR ILE MET LEU GLN CCAAGACGAATGTAGTACGATCTC GGUUCUGCUUACAUCAUGCUAGAG GLY SER ALA TYR ILE MET LEU GLU ...
View Full Document

Ask a homework question - tutors are online