Home work 5

Home work 5 - a) draw a double stranded piece of DNA...

Info iconThis preview shows pages 1–2. Sign up to view the full content.

View Full Document Right Arrow Icon
Home Work 5 Due Wednesday Sept 8 th 19 pts 1. Compare and contrast Bacterial and Eukaryotic Transcription (5pts) and Translation (5pts). 2. Based on the DNA sequence below, transcribe and translate the message with the assumption that the first “A” is the start of transcription. Find the appropriate start and translate. (4 pts) 5’…AGCTTATGCAGGACTTACTATGCTAAGGCCCTGAGAGTAGTTAGCTA…3’
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
The whole point of transcription and translation is to create a protein using the information contained in DNA.
Background image of page 2
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: a) draw a double stranded piece of DNA containing a gene (with a start codon, additional nucleotides and a stop codon) that will result in the protein MetAlaLeuPro when transcribed and translated. Label the DNA with all the other components required to transcribe that gene. b) Execute transcription on what you created in part a) generating the appropriate mRNA. c) Perform translation on what you generated in part b). Draw a simple diagram of each charged tRNA that was used in this process....
View Full Document

Page1 / 2

Home work 5 - a) draw a double stranded piece of DNA...

This preview shows document pages 1 - 2. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online