Turkey Day Work

Turkey Day Work - TanishaBillups Bio120 November30,2010...

Info iconThis preview shows pages 1–2. Sign up to view the full content.

View Full Document Right Arrow Icon
Tanisha Billups Bio 120 November 30, 2010 BRING YOUR COMPLETED RESPONSES TO CLASS on NOV 30 th or DEC 1 st (your first class meeting following the Thanksgiving Break). Use Campbell Chapter 17 and other sources to complete this activity. First, number each line of DNA from 1-4, starting with the first line.  Then cut the four lines out and tape together in order.   DNA is read like a book:  from left to right. The highlight portion is one continuous DNA from 5’ to 3’. Its complementary  strand is not highlighted.  Here is the DNA molecule (1) you will be using for your TURKEY WEEKEND ACTIVITY. 1. 5'            ATAGCGTCTATACACGTGTTACGTATGGCCCGGGCGCACCGATTATAT 3'      TATCGCAGATATGTGCACAATGCATACCGGGCCCGCGTGGCTAATATA   1 5’                                 AUGGCCCGGGCGCACCGAUUAUAU 2. 5'      GGAGTTAACGTACGTATCATCGTACTAGCATGATCTTGATCGATCGAT 3'    CCTCAATTGCATGCATAGTAGCATGATCGTACTAGAACTAGCTAGCTA   1 2 5’    GGA GUUAACGUACGUAUCAUCGUACUAGCAUGAUCUUGAUCGAUCGAU 3. 5'      CGTCATGCATGCTGACTGACATGCATGCGTACGTAAGCATGCATGCAT 3'    GCAGTACGTACGACTGACTGTACGTACGCATGCATTCGTACGTACGTA   2 3 5’   
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Image of page 2
This is the end of the preview. Sign up to access the rest of the document.

Page1 / 3

Turkey Day Work - TanishaBillups Bio120 November30,2010...

This preview shows document pages 1 - 2. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online