Lecture 17 supplement

Lecture 17 supplement - 10/28/2009 In situ hybridization In...

Info iconThis preview shows pages 1–2. Sign up to view the full content.

View Full Document Right Arrow Icon
10/28/2009 1 In situ hybridization DNA RNA denature bid i ‘ robe’= fluorescently hybridize probe fluorescently labeled anti-sense oligonuclotide nucleus Specific sequence recognized by ‘probe’ chromosomes mRNA Cell In situ hybridization Can be used to detect RNA or DNA DNA denature -> single strands synthetic “antisense” oligonucleotide = “probe” beled antibody ATTCGGCCAATTCAGGCTTATTTACGGGCGCATCAG AAGTCCGAATAAATGCCCGC * * * * * * * * * * * * * * * * * * * Single strand DNA labeled antibody DNA fragment containing sequence of interest Viral promoter for in vitro transcription Viral promoter for in vitro transcription SP6 T7 Probes for in situ hybridization R1 R2 origin of replication Antibiotic (generally ampicillin) resistance for selection For propagation of plasmid in bacteria Amp Common viral RNA polymerases: SP6, T3, T7 R1 and R2 = Sites for restriction digestion to produce linear lasmid ‘Linearization’ used to terminate in vitro transcription (R1:
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Image of page 2
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 06/05/2011 for the course BIO 200 taught by Professor Thomasebureau during the Fall '07 term at McGill.

Page1 / 2

Lecture 17 supplement - 10/28/2009 In situ hybridization In...

This preview shows document pages 1 - 2. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online