TypeI Termination - 5' U AA U C C C A C A G C C G C C A G...

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
TERMINATION OF TRANSC lU PTION IN BACTERIA » Type I - Relies on inverted repeats (stem/loop structure) and not on any additional protein factor » Type II - Relies on association ofadditional p (rho) polypeptide factor TemplateDNA 3' ATT AGGGTGTCGGCGGTCAAGGCGACCGCCGTAAAAAAAA 5' RNA (w/2 inverted repeats)
Background image of page 1
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: 5' U AA U C C C A C A G C C G C C A G UUC C GC U G G C G G C A UUUU UUUU 3' Template DNA 3' ATT AGGGTGTCGGCGGTCAAGGCGACCGCCGTAAAAAAAA 5' ,. I.tl' ' I V' ,. A rJUW fl U II ' RNA A -e. c, .. Gr f< 'A , It e rr(, c. t. ~ G. ~ e '-V e tc,s .F A 4 ..... , A .." \J .J ~ tI C C IC:_ -. ..a. .....
View Full Document

Ask a homework question - tutors are online