TypeI Termination - 5 U AA U C C C A C A G C C G C C A G...

Info icon This preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
TERMINATION OF TRANSC lU PTION IN BACTERIA » Type I - Relies on inverted repeats (stem/loop structure) and not on any additional protein factor » Type II - Relies on association of additional p (rho) polypeptide factor TemplateDNA 3' ATT AGGGTGTCGGCGGTCAAGGCGACCGCCGTAAAAAAAA 5' RNA (w/2 inverted repeats)
Image of page 1
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: 5' U AA U C C C A C A G C C G C C A G UUC C GC U G G C G G C A UUUU UUUU 3' Template DNA 3' ATT AGGGTGTCGGCGGTCAAGGCGACCGCCGTAAAAAAAA 5' ,. I.tl' ' I V' ,. A rJUW fl U II ' RNA A -e. c, .. Gr f< 'A , It e rr(, c. t. ~ G. ~ e '-V e· tc,s .F A 4 ..... , A .." \J .J ~ tI C C • IC:_ -. ..a. .....
View Full Document

{[ snackBarMessage ]}

What students are saying

  • Left Quote Icon

    As a current student on this bumpy collegiate pathway, I stumbled upon Course Hero, where I can find study resources for nearly all my courses, get online help from tutors 24/7, and even share my old projects, papers, and lecture notes with other students.

    Student Picture

    Kiran Temple University Fox School of Business ‘17, Course Hero Intern

  • Left Quote Icon

    I cannot even describe how much Course Hero helped me this summer. It’s truly become something I can always rely on and help me. In the end, I was not only able to survive summer classes, but I was able to thrive thanks to Course Hero.

    Student Picture

    Dana University of Pennsylvania ‘17, Course Hero Intern

  • Left Quote Icon

    The ability to access any university’s resources through Course Hero proved invaluable in my case. I was behind on Tulane coursework and actually used UCLA’s materials to help me move forward and get everything together on time.

    Student Picture

    Jill Tulane University ‘16, Course Hero Intern