Tutorial 11 answers - 3’-T TCAGCATTGGAACGTG CCATCG-5’...

Info iconThis preview shows pages 1–2. Sign up to view the full content.

View Full Document Right Arrow Icon
Questions 1. Which of these can DNA polymerase add on to? A) 5’----------------------------------3' 3’----------------------------------5’ B) 5’-------------------3’ 3’----------------------------------5’ C) 5’----------------------------------3’ 3’-------------------5’ B) Has the 3’ hydroxyl group ready for elongation where neither A nor C have that group. In addition, B has the template provided at the 3’ hydroxyl. Answer choice A has no template or 3’ hydroxyl. Choice C on the other hand, has a template, but it is overhanging a 5’ hydroxyl which cannot be used by the polymerase. 2. Write the complimentary strand that the polymerase will add to the polarity of the new sequence. 5’-TTAGC CTAATGTTGTAATCATGATGAATTGCG -3’ 3’-AATCGGATTACAACATTAGTACTACT TAACGC-5’ 3. Given a sequence of double stranded DNA, name the primers, both forward and reverse that would anneal to the sequence (only extend the primers for 6 bases). 5’- AAGTCG TAACC TTGCACGGTAGC-3’
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Background image of page 2
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: 3’-T TCAGCATTGGAACGTG CCATCG-5’ Forward Reverse A) 5’-AACCTT-3’ 5’-AAGTCG-3’ B) 5’-TTCAGC-3’ 5’-CGGGGC-3’ C) 5’-AAGTCG-3’ 5’-GCTACC-3’ D) 5’-GGTAGC-3’ 5’-GCCCCG-3’ E) 5’-ATGCGT-3' 5’-TTGGAA-3' C) The forward 5’ to 3’ primer would be complimentary to the left hand 3’ end. The primer will appear as the non-template strand of DNA. When we do the same for the other 3’ end, we get the reverse of the non-template strand of DNA. 4. Design primers that will amplify the following region of DNA (assume this is one strand from a double stranded region of DNA). The primers should be 15 bases in length in 5’ – 3’ orientation. 5’- GGATCGATCAAGAACAATGACAGGATCGAGGAATTCAGCCTACGCAGCGAGTAGCTGGAGGGA-3’ 3’- CT CATCGACCT CCCT-5’ 5’- GGATCGATCAAGAAC-3’ 3’- CC TAGCTCGTTCTTGTTACTGTCCTAGCTC CTTAAGTCGGATGCGTCGCTCATCGAGGTCCCT-5’ In 5’-3’ orientation the primers are: F: GGATCGATCAAGAAC R: TCCCTCCAGCTACTC...
View Full Document

{[ snackBarMessage ]}

Page1 / 2

Tutorial 11 answers - 3’-T TCAGCATTGGAACGTG CCATCG-5’...

This preview shows document pages 1 - 2. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online