Gene_finding - 3 Genome Annotation Gene Prediction • Gene...

Info iconThis preview shows pages 1–6. Sign up to view the full content.

View Full Document Right Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: 3. Genome Annotation: Gene Prediction • Gene : A sequence of nucleotides coding for protein • Gene Prediction Problem : Determine the beginning and end positions of genes in a genome Gene Prediction: Computational Challenge Gene Prediction: Computational Challenge aatgcatgcggctatgctaatgcatgcggctatgctaagctgggatccgatgacaa tgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgc taagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatt taccttggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaa tggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctggga tccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatcc gatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctgggat ccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatcct gcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatcc gatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatat gctaatgcatgcggctatgctaagctgggaatgcatgcggctatgctaagctggga tccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatcc gatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctcatgc ggctatgctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaat gcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgct aagctgcggctatgctaatgcatgcggctatgctaagctcggctatgctaatgaat ggtcttgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggc tatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctat gctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgc ggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctg cggctatgctaatgcatgcggctatgctaagctcatgcgg Gene Prediction: Computational Challenge aatgcatgcggctatgctaatgcatgcggctatgctaagctgggatccgatgacaa tgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgc taagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatt taccttggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaa tggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctggga tccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatcc gatgactatgctaagctgcggctatgctaatgcatgcggctat gctaagctgggat ccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatcct gcggctatgctaatgaatggtcttgggatttaccttggaatgctaagctgggatcc gatgacaatgcatgcggctatgctaatgaatggtcttgggatttaccttggaatat gctaatgcatgcggctatgctaagctgggaatgcatgcggctatgctaagctggga tccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatcc gatgactatgctaagctgcggctatgctaatgcatgcggctatgctaagctcatgc ggctatgctaagctgggaatgcatgcggctatgctaa gctgggatccgatgacaat gcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgct aagctgcggctatgctaatgcatgcggctatgctaagctcggctatgctaatgaat ggtcttgggatttaccttggaatgctaagctgggatccgatgacaatgcatgcggc tatgctaatgaatggtcttgggatttaccttggaatatgctaatgcatgcggctat gctaagctgggaatgcatgcggctatgctaagctgggatccgatgacaatgcatgc ggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctg cggctatgctaatgcatgcggctatgctaagctcatgcgg Gene Prediction: Computational Challenge aatgcatgcggctatgctaatgcatgcggctatgctaagctgggatccgatgacaa tgcatgcggctatgctaatgcatgcggctatgcaagctgggatccgatgactatgc taagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatt taccttggaatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaa tggtcttgggatttaccttggaatatgctaatgcatgcggctatgctaagctggga tccgatgacaatgcatgcggctatgctaatgcatgcggctatgcaagctgggatcc...
View Full Document

{[ snackBarMessage ]}

Page1 / 43

Gene_finding - 3 Genome Annotation Gene Prediction • Gene...

This preview shows document pages 1 - 6. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online