2002 Exam 1 STAFF

2002 Exam 1 STAFF - BIOL 4374/BCHS 4313 Cell Biology Exam...

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
1 BIOL 4374/BCHS 4313 Cell Biology Exam #1 September 30, 2002 SS#_____________________ Name_____________________ This exam is worth a total of 100 points. The number of points each question is worth is shown in parentheses. Good luck! 1. (3) The codons 5’ ACA 3’, 5’ ACU 3’ and 5’ ACC 3’ can all be read by the anticodon: a) 5’ IGU 3’ b) 5’ GGU 3’ answer: a c) 5’ UGI 3’ d) 5’ UGU 3’ e) 5’ IGC 3’ 2. (3) In the mRNA below, bracket the start codon and the stop codon and indicate how many amino acids the protein would encode. 1 2 3 4 5 6 7 8 9 5’ CGAUCACCCACCAUGGUACAUCUACAUACAUUACAGGACUGA CAUGUAAUAG 3’ 3. (2) An amino acid is bound to its appropriate tRNA by the enzyme ___aminoacyl-tRNA synthetase_______. 4. (2) Label the indicated parts of the reaction below: _peptidyl transferase_ ___amino acid #1___ __amino acid #2__ __peptide bond___ H C R NH 2 COOH H + C R NH 2 COOH H C R N COOH H C C R NH 2 H O Enzyme
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
2 5. (5) Match the translation factors with their functions. ___c____ EFTu a) Binds 5’ mRNA cap, unwinds mRNA and scans mRNA for start codon ___d____ EIF2 b) Brings the large ribosomal subunit into the initiation complex ___e____ RFs c) Brings ternary complexes to the A site of the ribosome ___a____ EIF4 d) Brings the first ternary complex to the P site of the small subunit ___b____ EIF5 e) Recognize stop codons and terminate translation 6. (4) Of the five amino acid sequences below, the most hydrophobic one is __c__ and the most charged one is ___e__. a) Lys Val His Glu Gln Gly Ile Ala Pro Asp Ala Glu Met Asn Cys b) Phe Ala Arg Leu Ser cys Lys Ala Glu Gln Pro Trp Tyr Leu Asp c) Try Trp Phe Ala Leu Ile Val Pro Gly Ser Met Asn Leu Thr Ile d) Cys Asn Pro His Gly Gly Leu Thr Gln Cys Ser Ser Pro Gly Asn e) Asp Lys Gln Gly Asp Arg Arg Thr His Gln Glu Asp Arg Lys Lys 7. (2) As proteins are translated, the chaperone ___hsp70__ binds to them and assists them to ___fold properly___. 8. (2) When a protein has been ubiquitinated, it is destined to be ___degraded__ in the __proteasome__. 9. (4) Describe two parameters that affect an enzymes rate of product formation. 1.
Background image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

Page1 / 7

2002 Exam 1 STAFF - BIOL 4374/BCHS 4313 Cell Biology Exam...

This preview shows document pages 1 - 3. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online