{[ promptMessage ]}

Bookmark it

{[ promptMessage ]}

ch9 - Technologies STEP-BY-STEP GUIDE Major Concepts The...

Info icon This preview shows pages 1–10. Sign up to view the full content.

View Full Document Right Arrow Icon
Image of page 1

Info icon This preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Image of page 2
Image of page 3

Info icon This preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Image of page 4
Image of page 5

Info icon This preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Image of page 6
Image of page 7

Info icon This preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Image of page 8
Image of page 9

Info icon This preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Image of page 10
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: Technologies STEP-BY-STEP GUIDE Major Concepts The development of recombinant DNA technology has revolutionized the way we study cells and their bio- molecules. Cloning technology provides researchers with the ability to “out and paste” selected pieces of DNA and to insert them into many different types of cells. The basic tools are the following: (1) the “scissors” are sequeneeepecific endonucieases, or restriction endonucleases; (2) the “paste" is the enzyme DNA ligase; and (3) the vehicles to move the DNA pieces around, called vectors, are self-replicating DNAs (plasmids, bacteriophages, and artificial chromo— somes) that can insert themselves into host cells. The recombinant DNA, then, is the vector DNA with a small piece of foreign DNA that has been inserted with the aid of restriction endonucleases and DNA ligase. variety of techniques can be used to insert vectors containing foreign DNA into a host cell, which is often a strain of E. coli, in a process called transfomation. 'Once inside cells, the vector DNA replicates producw g many copies of the foreign DNA along with the vector DNA. Not all cells are transformed by these rocedures, however, and a process must be one ployed to select the cells that actually contain the recombinant DNA. The end result is a renewable (home of a specific piece of DNA that can be repliw ated, transcribed, and translated in essentially un- _‘ted quantities. Pin mics is the study of the DNA sequence of on Q ism. H.318 Cloning technology, the complete complement DNA (genome) from a number of organisms has Ben cut into smaller, overiapping piecesand stored DNA—Based Information in “libraries.” The DNA pieces in such libraries can then be sequenced and the location of the sequence on a chromosome can be determined. The result is that entire genomes have now been sequenced. This sequence information is being “mined“ to discover new genes, to provide insights into genome organiza- tion and chromosome structure, to elucidate evolu- tionary relationships between organisms, and to de- velon new ways to treat diseases and much more. Protect/nice is a new field of investigation that at tempts to ascribe a function to all the proteins en- coded by the genes in d genome. With a huge amount of sequence information available for a growing number of organisms, researchers are now faced with the larger challenge of determining the function of all the encoded proteins. Knowledge of protein structure is an important aspect of this area of research because a protein’s function and its ability to interact with other cellular components is largely determined by its 3—D shape. Recombinant DNA technology provides tools for use in research, medical therapies, and commercial pro- duction. ' The ability to express cloned genes and obtain iarge quantities of the encoded protein is the basis for many of the applications of recombinant DNA technology (e.g., the production of erythropoietin). The ability to amplify specific DNA sequences using the poiymerase chain reaction (PCR) makes it possible to detect as little as one copy of a DNA molecule (which is useful in the early detection of viral infections such as the human inunu'nodeficiency virus). Site-directed muta— genesis techniques allow researchers to selectively a1- ter genes, thereby manipulating protein functional 113 1 14 Chapter 9 DNA-Based information Technologies domains and gaining insights into protein function (ultimately it may be possible to design proteins with specific functions “from scratch”). What to Review Answering the following questions and reviewing the rel- evant concepts, which you have already studied, should make this chapter more understandable. - Recombinant DNA technology makes use of many of the biochemical teclmiques already introduced in the text. A thorough understanding of the princi» pies underiying these methods will make it easier for you to follow the discussion of recombinant DNA technology. These techniques include (but are not limited to): Gel electrophoresis (pp. 88-90) Use of antibodies for isolation, detection, and locai— ization of proteins (pp. 173—174) DNA sequencing techniques (pp. 293—294) Review the structure of nucleotides and polynue cleotides from Chapter 8. The generation of recombinant DNA involves the ioining of DNA pieces. Be sure you understand the structure of nucleotides and how they are joined to form. polynucieotides. Be very sure you understand how the DNA strands in the double heiix are ori— ented with respect to their 5’ and 3’ ends. Much of recombinant DNA technology relies upon the ability of DNA and RNA to form duplexes and hybrid duplexes. Be sure that you understand the molecular basis for basewpair formation between polynucleotide strands (pp. 288—289) and the corn cept of complementarity (pp. 279—280). Chromatography techniques (pp. 85~87) Topics for Discussion Answering each of the following questions, especially in the context of a study group dis— cussion, should help you understand the important points of this chapter. 9.1 DNA Cloning: The Basics Use the information in the introduction to this section and draw your own diagrams or car- _° toons that illustrate each of the steps involved in cloning a piece of DNA; try to do this with— ' out copying from the text. Restriction Endanucleases and DNA Ligase Yield Recombinant DNA 1. Endonucleases and ligases are normal constituents of some cells. What are the biologi— cal functions of these enzymes? 2. How do bacteria protect themselves from their own enzymes? 3. Why can restriction enzymes be thought of as molecular scissors? What bond in DNA do they cieave? 4. Why are restriction enzymes so cruciai to the ability to clone DNA? 5. Why are Type II restriction endonucieases used for DNA cloning and not Types 1 and ill? Step~by~8tep Guide 1 15 6. How might the use of a restriction enzyme that produces sticky ends in a cloning pro— tocol provide an advantage over the use of one that produces blunt ends? What makes “sticky ends” sticky? ’7. Which restriction enzyme (3) would you use to cleave the poiyh‘nker region of the vec« tor shown in Figure 9—3 if you wanted to insert the foliowing “out” pieces of DNA? a} GATCCTGCAGAAGCTTCCGGATCCCCGG GAOGTC'ITCGAAGGCC’I‘AGGGGCCCTAG b} AATTCTGCAGAAGCTTCCGGATCCCCGG GACGTCTTCGAAGGCCTAGGGGCCTCGA Would the orientation of the inserted piece be the same in both cases? Cloning Vectors Allow Amplification of Inserted DNA Segments 8. Why is it important that vectors be able to replicate autonomously? Given that plasmid DNA is self-replicating, why must it be inserted into a host cell? 9. After you read this section, use the diagram below and try to labei the various elements of an E. colt plasmid Without iooiiing at the text. Label the following: on”, the origin of replication; tetR, tetratcyciine resistance gene; ampR, the ampicillin resistance gene; the polyEinker region. 10. Why does the positioning of these elements in the vector matter? Where would you in- sert the foreign gene? 1 1. Why are two antibiotics used to screen for incorporation of a plasmid? Why do some of the transfected bacteria grow on plates containing ampicillin? 116 Chapter 9 DNAuBased information Technologies 12. What is the advantage of using bacteriophages as vectors compared to plasmids? 13. In What ways does cioning in yeast differ from cloning in E. colt? Specific DNA Sequences Are Detectable by Hybridization 14. What is the molecular basis for the use of labeled probes to identify clones contairdng specific DNA sequences? 15. What are the different ways that DNA probes can be generated? Expression of Cloned Genes Produces Large Quantities of Protein 16. What elements do you need to add to the figure you generated in question 8 to create an expression vector? Alterations in Cloned Genes Produce Modified Proteins 17. How might you use site-directed mutagenesis to study the function of human hemoglo- bin {see Chapter 5 in your text)? 18. What are the different strategies for generating specific mutations in cloned DNA se- quences? Terminal Tags Provide Binding Sites for Affinity Purification 19. E. colt expression vectors, e.g., Fig. 19—10, containing a terminal tag sequence, are comerciaily availabie. Indicate in your diagram from question 9 Where these sequences must be located. 9.2 From Genes to Genomes DNA Libraries Provide Specialized Catalogs of Genetic Information 20. How are the DNA pieces used to construct a genomic library obtained? 21. How are the DNA pieces used to construct a cDNA iibrary generated? 22. What is absent from the cloned DNA in a cDNA library that is present in the DNA of a genomic library? (Hint: consider the source!) The Polymerase Chain Reaction Amplifies Specific DNA Sequences 23. What characteristic of DNA duplexes is critical to the successful application of the PCR technique? Step-by-Step Guide 117 Genome Sequences Provide the Ultimate Genetic Libraries 24. How much of the human genome encodes functional proteins? 25. What are possibie functions of the rest of the DNA? 26. In what ways can you envision information about the sequence of the human genome being used? Box 9—1 A Patent Weapon in Forensic Medicine 27. In DNA fmgerprintnig, a DNA probe is used to iabel a few of the thousands of DNA “bands“ that are generated when genomic DNA is digested with restriction enzymes. What type of “probe" is used in this procedure and how is it generated? 28. When using this technique to match DNA samples, what can one do to increase the odds that the DNA in two different samples comes from the same source? ' 9.3 From Genomes to Proteomes 29. What is the difference between genotype and phenotype? Sequence or Structural Relationships Provide information on Protein Function 30. What classes or types of genes would you expect to eidnbit the most simiiarity between bacteria and humans? Between Drosophila and humans? Between rats and humans? Cellular Expression Patterns Can Reveal the Cellular Function of a Gene 31. When genes are screened using DNA microarrays, what is the source of the probe? is it the same type of probe used for DNA fingerprinting? Detection of Proteln~Protein Interactions Helps to Define Cellular and Molecular Function 32. What types of protein—protein interactions have you encountered so far in this text and what types of bonds are invoived in these interactions? (See Chapters 4, 5, and 6.) 33. Can you come up with an exampie of a celiular function that could be defined by knowi- edge of a specific protein-protein interaction? 34. In a yeast two-hybrid screen, how do you know that you have found a set of proteins that interact? g . e | 118 Chapter 9 DNA~Based information Technologies 9.4 Genome Alterations and New Products of Biotechnology A Bacterial Plant Parasite Aids Cloning in Plants s, new genes are introduced using an engineered shut- be inserted, a selectable marker, and two TmDNA rew lude an engineered Ti plasmid that no longer con- 35. In the transformation of plant cell tle vector containing the gene to peats. Why is it also necessary to inc tains its T-DNA gene? Manipulation of Animal Cell Genomes Provides information on Chromosome Structure and Gene Expression 36. The Human Immunodeficiency Virus (HEV) is a retrovirus. In what way are re an important tool for use in gene therapy? troviruses edite the Disco very of New Pharmaceuticals New Technologies Promise to Exp with your answer to question 33. 37. Information in this section should help you Box 9-2 The Human Genome and Human Gene Therapy egies discussed in this section involved gene transformation of would treatment of genetic diseases that involve other organs cts lung function) require somewhat 38. ri‘he therapeutic strat bone marrow cells Why (cg, cystic fibrosis is a genetic disease that affe different strategies? Recombinant DNA Technology Yields New Products and Challenges 39. Can you come up with additional genes/proteins (human or otherwise) useful if cloned? that would be 40. What are the benefits and potential hazards to the use of these genes or proteins? Discussion Questions for Study Groups 0 What are some of the practical plied to humans. it What do you think or 0 Do you think the potential benefits outweigh the potential pr - Can you think of a human gene that would be useful to clone? chnologies? e the major ethical hurdles to the practical use of recombinant DNA to oblerns? SELF-TEST Do You Know the Terms? AGRflSS i. Vectors of choice for medinm~size DNA fragments. 5. One approach to - mutagenesis is to use an oligonucleotide pn'rner containing an altered base for the synthesis of a duplex DNA. I 7. The new, improved product of two fused genes is a protein. 8. Small, circular, extrachro— rnosomai DNA moiecnle. Viral are often modified retroviruses. A genomic con tains more information than its largest “homolog” at any university. Synthetic DNA fragment with recognition sequences for severai restriction endonucieases. These cleave DNA at specific base sequences; the scaipels of moiecular bioiogy. {2 words) 6. In bacteria, event induced by a coici, calcium chloride bath foilowed by heat shock or a strong jolt of eiectricity. . Natural genetic engineer in piants. (2 words) Synthetic DNA, complementary in sequence to an RNA template. Cabin.) >4 N 10. 12. 13. WI.- 15. . T0 or not to is no longer the question; everyone in biochemistry is doing it! (Hint: to make an identical copy of an organism, a cell, or a DNA segment.) . (1 word) Describes composite DNA molecules containing DNA from two or more species. ducible promoter and a polylinker is called aCn) vector. Contains aii the genetic information to make an organism. Radioactive DNA fragment that can ferret out and bind to specific DNA sequences. _- Self-repiicating piece of DNA that is capable of surviving both E. colt and S. composing (2 words) Shocking technique that makes cells transiently permeable to DNA. IEJ'Oins DNA strands; molecular “glue.” (2 words) . Describes ends of DNA fragments that have no overhang. III-II “III-II... ” HIIIIIIIIIIIIIIII “IIIHIIIIIIIII WIIIIWIII 10. 11. i3. 3.4. 17. 19. 22. 23. Self-Test 1 19 III... “I... vectors are the equivalent of a molecular “syringe.” Differences in iengths and sequences of DNA fragments produced by random cutting of genomic DNA by restric- tion enzymes; vary from one individual to another. (abbr.) Gene amplification technique that rehes on the activity of a heatmstable poiyrnerase (Tool) isolated from hot-spring bacteria. Cabin.) ri‘he fluorescent zebrafish in Figure 9433 is an example of a animai. Restriction endonucieases that make staggered cuts produce . (2 words) Follovnng electrophoresis, proteins can be identified using antibodies in a Western biot, mRNA can be identified using DNA probes in a Northern biot, and DNA fragments can be identified using DNA probes in a __ blot. Used for cloning genomic DNA, these vectors are actuaily unstable when they contain inserts of less than 100,000 bp. Aithough it’s not the “irricro” variety used in computers, this “DNA” version aiso contains an enormous amount of information. 120 Chapter 9 DNA-Based Information Technologies Do You Know the Facts? 1. Questions 1H5 refer to the following illustration. The iilustration below shows a fragment of DNA that has been isolated from a genomic DNA library. The frag- ment contains a protein-coding region (indicated by the black box); the sites at which a number of restriction endonucleases cut (a restriction map) are indicated. Also shown is a plasmid that has been engineered to be used as an expression vector (the curved arrow indicates the direction of translation from the promoter); its restric- tion enzyme sites are indicated. Genomic DNA Regiment 3'—___~—~——~ iii iii Hindfll EcoRl EcoRI BomHl Pstl Ciel 5 Expression Vector E’TGinducible Name the region of the piasrnid, near the promoter, where Pstl, BamHl, EooRi, Hindlil, and Ciel have recogni— tion sequences. If you cut the vector with the restriction enzyme BamHi, how many pieces will you get? You wish to insert the coding region of the DNA fragment into the expression vector so that the gene will be «are pressed (is, produce the protein it codes for). indicate where the gene fragment must be inserted into the vec- tor and the orientation it must have. if your goal is to obtain only a portion of the totai protein for use in generating antibodies, which single enzyme could you use to out the vector and the DNA fragment so that the vector could produce ali or part of the pro— tein? Would all, vectors with inserts make protein? If your goal is to produce a complete, functional protein, could you still use a single restriction enzyme? Which enzyme or combination of enzymes could you use to get enough of the gene fragment into the vector to ensure formation of the entire gene product? Applying What You Know 1. You have received from a colleague a plasmid containing a piece of DNA that is expressed only in neuronal cells in Drosophtta. You suspect that this gene codes for some type of signaling peptide. (3.) What must you do to test your hypothesis? In other words, how do you get from a piece of DNA in a piss“ mid to the nucleotide sequence to a protein you can examine functionally? . (b) How could you find out Whether the gene is present in other species (eg, a laboratory rat) and determine its pattern of expression? (c) Why would you or anyone care what proteins are present in Drosophtla or in the tab rat? express this protein. ANSWERS Do You Know the Terms? ACRQSS 1. bacteriophages 5. site—directed 7. fusion 8. piasmid 10. vectors 12. library 13. polylinker 15. restriction enzymes . 16. transformation 18. a plasmid 20. cDNA 21. blunt 23. cione 24. recombinant III-)0 You Know the Facts? 1. The poiylinker region. 2. Three pieces. 3.‘ The gene fragment must be inserted in the poiylinker region, adjacent to and to the right of the promoter region. It must be oriented with its 5’ end to the left (at the beginning of the curved arrow) and its 8' end to the right (at the arrowhead end): The DNA fragment Wili be flipped 180° relative to its orienta» tion in the illustration. ' You can use 5200121 to cut the vector and the DNA _. fragment; this will linearize the circular plasmid so ._ that you can insert the fragment. You wiil also ob— - tain a piece of the coding region that includes the genes for the carboxyl~ternunai hair of the protein. ' Because all the ends are cut with the same restric- i-tion enzyme, ali are compatible This means that the inserted DNA can be oriented in either the _—~«>3' or the 3’w95 direction. However oniy those lasrruds with inserts oriented in the 5 '«eB’ direc- gm Will be abie to translate the entire piece of ' NA. 11 could cut the vector and the DNA fragment with two restriction enzymes: Pstl and thdlll. When the fragment is ligated into the vector its Answers 121 2. How wouid you generate DNA probes for the following applications? (a) You have isoiated an uncharacterized protein and you want to find out which cells and/or tissues actually (b) You have isolated the mRNA for insulin from sheep pancreas. Your goai is to isolate a cione containing the insulin gene from a human cDNA iibrary in order to produce authentic human insulin protein in E. coli. DOWN 2. expression 3. genome 4. probe 5. shuttie vector 6. electroporation 9. DNA ligase 10. viral 11. RFLPs 13. PCR 14. transgenic 17. sticky ends 19. Southern 22. YACs 23. chip Psthut 5‘ end wili be closest to the promoter {at the unique PstI site in the poiylinker) and its HindIH-cut 3’ end wili be farthest from the pro teeter (inserting into the unique Hindlil site in the poiylinker). Note that you wouid not want to use BamHl. It would insert the entire coding region into the vector in the correct orientation when used in concert with thdiil, but it also cuts at other sites within the vector. Applying What You Know 1. (a) The first step is to determine the DNA se» quence of the cloned gene. This can be...
View Full Document

{[ snackBarMessage ]}

What students are saying

  • Left Quote Icon

    As a current student on this bumpy collegiate pathway, I stumbled upon Course Hero, where I can find study resources for nearly all my courses, get online help from tutors 24/7, and even share my old projects, papers, and lecture notes with other students.

    Student Picture

    Kiran Temple University Fox School of Business ‘17, Course Hero Intern

  • Left Quote Icon

    I cannot even describe how much Course Hero helped me this summer. It’s truly become something I can always rely on and help me. In the end, I was not only able to survive summer classes, but I was able to thrive thanks to Course Hero.

    Student Picture

    Dana University of Pennsylvania ‘17, Course Hero Intern

  • Left Quote Icon

    The ability to access any university’s resources through Course Hero proved invaluable in my case. I was behind on Tulane coursework and actually used UCLA’s materials to help me move forward and get everything together on time.

    Student Picture

    Jill Tulane University ‘16, Course Hero Intern