JBiotech - DNA Technology DNA T E CHNO L O G Y But first...

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: DNA Technology DNA T E CHNO L O G Y But first before we splice a gene Lets think about the unforeseen Our good intent to hybridize Could engineer a bad surprise TERMINOLOGY Similar terms — often used interchangeably • Biotechnology: the manipulation of organisms to produce a product. – Fermentation, artificial breeding, pharmaceutical and nutritional supplements, and now … • Genetic engineering: the direct manipulation of an organism’s DNA. • Recombinant DNA: insertion of DNA from one source into another. • Transgenics: producing an organism with foreign DNA inserted into its genome. TOOLS & TECHNIQUES RESTRICTION ENZYMES • Restriction Digests • RFLP — “genetic fingerprinting” • Hybridizations & Molecular Probes • Polymerase Chain Reaction (PCR) • Recombinant DNA • Gene Cloning • Transgenics • Gene Expression Analyses • Genome Mapping & Sequencing RESTRICTION ENZYMES • Bacteria produce special enzymes to chop up viral DNA. • Biotechnologist use these “restriction enzymes” to cut DNA in specific places (restriction sites). • Many restriction enzymes cut the DNA polymer in a staggered pattern that produce “sticky” single-stranded ends to the DNA fragments. RESTRICTION FRAGMENT ANALYSIS DNA Technology as a diagnostic tool • Everyone’s DNA is unique • Closer the relationship the more similar the DNA • Restriction Fragment Length Polymorphisms – RFLPs – “Ruff-lips” Heyer 1 DNA Technology RESTRICTION DIGEST Æ RESTRICTION FRAGMENTS RESTRICTION USES OF RESTRICTION FRAGMENT ANALYSIS • Criminology USES OF RESTRICTION FRAGMENT ANALYSIS • Criminology • Missing persons • Paternity RESTRICTION FRAGMENT LENGTH POLYMORPHISM • Electrophoresis of fragments USES OF RESTRICTION FRAGMENT ANALYSIS • Missing persons USES OF RESTRICTION FRAGMENT ANALYSIS • Medicine – Inborn errors of metabolism • Carriers • Prenatal testing – Provirus DNA Heyer 2 DNA Technology RESTRICTION FRAGMENT ANALYSIS MOLECULAR PROBES CAN IDENTIFY SPECIFIC GENES • Genetic markers Hybridization: DNA/RNA hybrid molecule RESTRICTION FRAGMENT ANALYSIS RESTRICTION FRAGMENT ANALYSIS Normal b -globin allele • Comparing two different DNA molecules, such as two alleles for a gene • “Southern • Copies DNA fragments • Million copies/hr • Enough for RFLPs analysis, probes, sequencing, etc. With PCR, any specific segment —the target sequence —within a DNA sample sample can be copied many times (amplified) completely in vitro .! in Heyer DdeI Large fragment DdeI DdeI Sickle-cell mutant b-globin allele 376 bp Large fragment DdeI DdeI DdeI (a) DdeI restriction sites in normal and sickle-cell alleles of b-globin gene. Normal allele Sickle-cell allele Large fragment 201 bp 175 bp Figure 20.9a,b • PCR DdeI 376 bp Blotting” Polymerase Chain Reaction olymerase hain 201 bp 175 bp (b) Electrophoresis of restriction fragments from normal and sickle-cell alleles. Polymerase Chain Reaction olymerase hain All you need: • A heat-block that can rapidly and precisely change temperature (Thermocycler) • Primers bracketing the sequence of interest • A special heat-stable DNA-polymerase from a bacteria inhabiting hot-springs 3 DNA Technology RECOMBINANT DNA TECHNOLOGY Polymerase Chain Reaction olymerase hain 5¢ Genomic DNA Target sequence TECHNIQUE The starting materials for PCR are double-stranded DNA containing the target nucleotide sequence to be copied, a heat-resistant DNA polymerase, all four nucleotides, and two short, singlestranded DNA molecules that serve as primers. One primer is complementary to one strand at one end of the target sequence; the second is complementary to the other strand at the other end of the sequence. 3¢ 3¢ • The PCR procedure 5¢ 5¢ Heat briefly to separate DNA strands 2 Annealing: Cycle 1 yields 2 molecules 5¢ Figure 20.7 – In a test tube – Different sources of DNA Primers Cool to allow primers to hydrogen-bond. 3 Extension: RESULTS • During each PCR cycle, the target DNA sequence is doubled. •By the end of the third cycle, one-fourth of the molecules correspond exactly to the target sequence, with both strands of the correct length. (See white boxes in Cycle 3.) •After 20 or so cycles, the target sequence molecules outnumber all others by a billionfold or more. • Set of techniques for combining genes 3¢ 3¢ 1 Denaturation : – Same species – Different species New nucleotides DNA polymerase adds nucleotides to the 3 ¢ end of each primer • Transferring genes – Into cells Cycle 2 yields 4 molecules – Where they can be replicated Cycle 3 yields 8 molecules; 2 molecules (in white boxes) match target sequence GENES FROM ONE CELL CAN BE INSERTED INTO ANOTHER CELL PLASMIDS CAN BE USED TO CUSTOMIZE BACTERIA “Genetic Engineering” Cut and Paste: ¸ Restriction digest ¸ Anneal sticky ends ¸ DNA ligase ¸ Voila! ¯ Recombinant DNA Gene Cloning Gene Cloning APPLICATION Cloning is used to prepare many copies of a gene of interest for use in sequencing the gene, in producing its encoded protein, in gene therapy, or in basic research. TECHNIQUE 1 Isolate plasmid DNA and human DNA. Figure 20.4 5 Plate the bacteria on agar containing ampicillin and X-gal. Incubate until colonies grow. Colony carrying nonrecombinant plasmid with intact lacZ gene Restriction site amp R gene (ampicillin resistance) 3 Mix the DNAs ; they join by base pairing. The products are recombinant plasmids and many nonrecombinant plasmids. Recombinant bacteria lacZ gene (lactose Human breakdown) cell Bacterial cell 2 Cut both DNA samples with the same restriction enzyme Heyer 4 Introduce the DNA into bacterial cells that have a mutation in their own lacZ gene. In this example, a human gene is inserted into a plasmid from E. coli. The plasmid contains the ampR gene, which makes E. coli cells resistant to the antibiotic ampicillin. It also contains the lacZ gene, which encodes b-galactosidase. This enzyme hydrolyzes a molecular mimic of lactose (X-gal) to form a blue product. Only three plasmids and three human DNA fragments are shown, but millions of copies of the plasmid and a mixture of millions of different human DNA fragments would be present in the samples. Bacterial plasmid Bacterial clone Gene of interest Sticky ends Colony carrying recombinant plasmid with disrupted lacZ gene Human DNA fragments RESULTS Only a cell that took up a plasmid, which has the amp R gene, will reproduce and form a colony. Colonies with nonrecombinant plasmids will be blue, because they can hydrolyze X-gal. Colonies with recombinant plasmids, in which lacZ is disrupted, will be white, because they cannot hydrolyze X-gal. By screening the white colonies with a nucleic acid probe (see Figure 20.5), researchers can identify clones of bacterial cells carrying the gene of interest. Recombinant DNA plasmids 4 DNA Technology Identifying Clones Carrying a Gene of Interest Nucleic acid probe hybridization APPLICATION Hybridization with a complementary nucleic acid probe detects a specific DNA within a mixture of DNA molecules. In this example, a collection of bacterial clones (colonies) are screened to identify those carrying a plasmid with a gene of interest. • A clone carrying the gene of interest – Can be identified with a radioactively labeled nucleic acid probe that has a sequence complementary to the gene, a process called nucleic acid hybridization – Same procedure as identifying bands on a Southern blot TECHNIQUE Master plate Master plate Radioactive single-stranded DNA Gene of interest Film Single-stranded DNA from cell Filter Colonies containing gene of interest Probe DNA Solution containing probe Filter lifted and flipped over Hybridization on filter 1 A special filter paper is pressed against the master plate, transferring cells to the bottom side of the filter. RESULTS Figure 20.5 PLASMIDS CAN BE USED TO CUSTOMIZE BACTERIA Cells from each colony known to contain recombinant plasmids (white colonies in Figure 20.4, stap 5) are transferred to separate locations on a new agar plate and allowed to grow into visible colonies. This collection of bacterial colonies is the master plate. 2 The filter is treated to break open the cells and denature their DNA; the resulting singlestranded DNA molecules are treated so that they stick to the filter. 3 The filter is laid under photographic film, allowing any radioactive areas to expose the film (autoradiography). 4 After the developed film is flipped over, the reference marks on the film and master plate are aligned to locate colonies carrying the gene of interest. Colonies of cells containing the gene of interest have been identified by nucleic acid hybridization. Cells from colonies tagged with the probe can be grown in large tanks of liquid growth medium. Large amounts of the DNA containing the gene of interest can be isolated from these cultures. By using probes with different nucleotide sequences, the collection of bacterial clones can be screened for different genes. COMPLEMENTARY DNA Some problems: • Since <2% of human DNA carries genetic information, how do you know which parts have genes? • Since bacteria do not do post-transcriptional modification, how can they express eukaryotic genes? Answer: cDNA (complementary DNA) • Collect mRNA from cells of interest • Use reverse transcriptase to synthesize complementary DNA from mRNA template • cDNA used as probes Æ identify regions of genes! Transgenics: transferring DNA from one organism into another PHARMACEUTICAL BIOTECHNOLOGY Transgenic Bacteria • Protein production – – – – Insulin Growth hormone Erythropoietin Hepatitis B vaccine • Insert cDNA into plasmid Æ eukaryotic gene without the introns for bacterial expression! TRANSFORMING EUKARYOTES WITH RECOMBINANT DNA Transgenic Plants, Fungi, & Animals • Agrobacterium Ti plasmid – Natural pathogen of broad-leaf plants – Ti plasmid inserts into plant chromosome • Microparticle accelerator “gene gun ” – DNA fragments coated onto gold or tungsten particles – Particle blasted by gas pressure burst through tissue, leaving trail of DNA residue in cells • Microfiber “gene whiskers” – DNA fragments coated onto microscopic needles – Needles and cells suspended and shaken; impaled cells take up DNA from needles • Electroporation – Rapid electrical pulses induce cellular pores to open allowing small fragments of DNA to enter Heyer 5 DNA Technology AGRICULTURAL BIOTECHNOLOGY AGRICULTURAL BIOTECHNOLOGY soybean Top U.S. GMO* Crops corn GENE MICROINJECTION AND ANIMAL CLONING * Genetically Modified Organism Some proposed benefits of GMO crops: • Intrinsic pesticide (bacterial insect pathogens) • Herbiside resistance • Enhanced productivity • Enhanced shelf life ( FlaverSaver® tomatoes) • Frost resistance cotton PHARMACEUTICAL AGRICULTURAL BIOTECHNOLOGY “Pharming” • Microinjection is labor intensive • Cloning embryos is slow, expensive, and produces few recombinant subjects • Thus, use only for gene products with huge potential profits to justify the expense and effort. TRANSGENIC RESEARCH • Mice that are susceptible to human cancers or viruses BIOTECHNOLOGY RISKS • Risks – Health / Culture – Environment – Corporate patent monopolies – Test therapies Heyer 6 DNA Technology USES OF RESTRICTION FRAGMENT ANALYSIS • Gene Mapping – Genomics & Bioinformatics Construction of a Human Genomic Library Heyer Genetic Mapping: Relative Ordering of Markers • The initial stage in mapping a large genome is to construct a linkage map of several thousand genetic markers spaced throughout each of the chromosomes Cytogenetic map Chromosome banding pattern and location of specific genes by fluorescence in situ hybridization (FISH) 1 Chromosome bands Genes located by FISH Genetic (linkage) mapping Ordering of genetic markers such as RFLPs , simple sequence DNA, and other polymorphisms (about 200 per chromosome) 2 Physical mapping Ordering of large overlapping fragments cloned in YAC and BAC vectors, followed by ordering of smaller fragments cloned in phage and plasmid vectors 3 DNA sequencing Determination of nucleotide sequence of each small fragment and assembly of the partial sequences into the complete genome sequence Genetic markers Overlapping fragments …GACTTCATCGGTATCGAACT … Figure 20.11 Sequences of Base Pairs Mapping 7 ...
View Full Document

This note was uploaded on 09/02/2011 for the course BIOL 6B taught by Professor Heyer during the Spring '10 term at DeAnza College.

Ask a homework question - tutors are online