10-10 - BIO 5099: Molecular Biology for Computer Scientists...

Info iconThis preview shows pages 1–4. Sign up to view the full content.

View Full Document Right Arrow Icon
BIO 5099: Molecular Biology for Computer Scientists (et al) Lecture 14: Gene expression and regulation http://compbio.uchsc.edu/hunter/bio5099 Larry.Hunter@uchsc.edu Gene expression Some gene products are necessary only some of the time, e.g. In response to environmental stimuli, e.g. Presence (or absence) of certain foods or toxins Temperature change (heat shock, freezing) In response to life events, e.g. Reproduction Fending off predators or pathogens Expression of a gene is creation of its product Gene expression is regulated . [NB: recall transcription is always 5' 3'] Most genes are not expressed at a particular time Particularly true of multicellular organisms. e.g. Heart genes are not expressed in brain cells Even in prokaryotes, many genes are not expressed under “regular” circumstances Of the 4279 genes in E. coli, only about 2600 (~60%) are expressed in standard laboratory conditions Only about 350 genes are expressed at more than 100 copies (i.e. molecules!) per cell, making up 90% of the total protein. Transcription and translation are energetically expensive. Don't do them unless you have to.
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Some genes are always expressed Certain key genes are made at all times under all circumstances. E.g. Ribosomal proteins, tRNAs, RNA polymerase, glycolysis enzymes These are called constitutive genes. Other genes are made only at certain times or in certain conditions. These are under the control of regulatory apparatus, and can be expressed in widely varying amounts (called levels) These genes are called inducible genes. Two ways to regulate metabolism We saw last week that metabolism could be regulated by changing the activity of an enzyme (e.g. allosteric regulation) Metabolism can also be regulated by changing the concentration of an enzyme. This is accomplished primarily by regulation of the rate of synthesis of the enzyme, that is, of gene expression Rate of degradation is also under cellular control, although it is less specific. Expression regulation Portions of DNA upstream of the coding region contain specific sequences called transcription factor binding sites that are recognized by transcription factors (TFs) . The binding of TFs to TF binding sites controls the expression of a gene. tataattacctgaactagacatgattaacgctaagctcttac start of transcription coding sequence upstream region transcription factor binding site
Background image of page 2
Operons In prokaryotes (but not eukaryotes), genes are organized into functional groupings called operons Operons consist of two or more adjacent coding regions that are controlled by the same transcription factor. The genes in an operon
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Image of page 4
This is the end of the preview. Sign up to access the rest of the document.

Page1 / 10

10-10 - BIO 5099: Molecular Biology for Computer Scientists...

This preview shows document pages 1 - 4. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online