pCWORI Template DNA Sequence

pCWORI Template DNA Sequence - Template DNA for pCWORI

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
Template DNA for pCWORI (pCWORI+BM3p450+NsiI+6XHistag+STOP) *This plasmid is pCWORI containing a gene sequence for BM3p450 starting at the NdeI with the last six base pairs changed to make an NsiI site. Directly following the NsiI site is a 6X Histag followed by a stop codon. - For inserts with NdeI/NsiI sites going into pCWORI: Digest this template with NdeI and NsiI and extract the pCWORI fragment. - For inserts with BamHI/NsiI sites going into pCWORI: (only used if NdeI cuts your insert) Digest this template with BamHI and NsiI and extract the pCWORI fragment. **In bold is the BM3p450 (with the last two amino acids changed) gene fragment which will simply be digested out and only the pCWORI fragment will be isolated** **Underlined are the three possible restriction sites that can be used for putting your gene of interest into pCWORI** TTCACCACCCTGAATTGACTCTCTTCCGGGCGCTATCATGCCATACCGCGAAAGGTTTTGCGCCA TTCGA TGGTGTCCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATG TGAGTTA GCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATAATGTGTGGAATTG TGAGC GGATAACAATTTCACACAGGAAACAGGATCGATCCATCGATGAGCTTACTCCCCATCCCCCTGT TGACAA TTAATCATCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGG ATCAGC TTACTCCCCATCCCCCTGTTGACAATTAATCATCGGCTCGTATAATGTGTGGAATTGTGAGCGGA TAACA ATTTCACACAGGAAACAGGATCC ATCGATGCTTAGGAGGTCATATG ACAATTAAAGAAATGCC TCAGCCA AAAACGTTTGGAGAGCTTAAAAATTTACCGTTATTAAACACAGATAAACCGGTTCAAGCTT TGATGAAAA TTGCGGATGAATTAGGAGAAATCTTTAAATTCGAGGCGCCTGGTCGTGTAACGCGCTACT TATCAAGTCA GCGTCTAATTAAAGAAGCATGCGATGAATCACGCTTTGATAAAAACTTAAGTCAAGCGCTT AAATTTGTA
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
CGTGATTTTGCAGGAGACGGGTTATTTACAAGCTGGACGCATGAAAAAAATTGGAAAAAA GCGCATAATA TCTTACTTCCAAGCTTCAGTCAGCAGGCAATGAAAGGCTATCATGCGATGATGGTCGATAT CGCCGTGCA GCTTGTTCAAAAGTGGGAGCGTCTAAATGCAGATGAGCATATTGAAGTACCGGAAGACAT GACACGTTTA ACGCTTGATACAATTGGTCTTTGCGGCTTTAACTATCGCTTTAACAGCTTTTACCGAGATC AGCCTCATC CATTTATTACAAGTATGGTCCGTGCACTGGATGAAGCAATGAACAAGCTGCAGCGAGCAA
Background image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

Page1 / 6

pCWORI Template DNA Sequence - Template DNA for pCWORI

This preview shows document pages 1 - 3. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online