biol139-lecture28-2011

biol139-lecture28-2011 - BIOL 139 The genetic code The...

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: BIOL 139 The genetic code The Chapter 8 Chapter pp 255 - 265 pp pp 359 - 363 igenetics pp Gene expression: The flow of genetic information from DNA via RNA to protein Gene: nucleotide sequence of DNA that encodes for a specific protein or polypeptide The genetic code The How can 4 nucleotides encode 20 amino acids? Through groupings into triplets Each codon specifies only ONE amino acid The genetic code (mRNA) In mRNA, Uracil (U) is substituted for Thymine (T) In You could deduce the code for DNA by making these substitutions i.e. T for U A gene’s nucleotide sequence is colinear colinear with the encoded polypeptide (protein) 5’ XXX XXX XXX XXX NH2 DNA nucleotides 3’ gene COOH Amino acid sequence Linear relationship between the nucleotide sequence in a gene (or mRNA transcript) and the order of amino acids in the polypeptide chain specified by the gene Each has a polarity i.e. 5’-3’ polarity of DNA corresponds to the polarity of the protein.. that is NH2 end of the protein corresponds to the 5’ end of DNA and COOH is always at the end which corresponds to the 3’ end Reading frame Reading 1961- Francis Crick and Sydney Brenner published a report of their studies of the Bacteriophage T4 rIIB gene rIIB Their conclusion: A codon is composed of three Their nucleotides and the designated starting point for each gene establishes the reading frame for these reading triplets triplets Start Gene Open Reading Frame Stop DNA Gene Reading frame : the partitioning of groups of Reading three nucleotides such that the sequential three sequential interpretation of each succeeding triplet generates interpretation the correct order of amino acids in the resulting polypeptide chain polypeptide Start 5’ Stop xxx Open Reading Frame 3’ Gene Triplet in DNA 5’ xxx 3’ Codon in mRNA NH2 Correct order of amino acids COOH Start triplet must be in frame with the stop triplet in Intragenic Suppression: Intragenic The restoration of gene function by one mutation canceling the other in the same gene Induced Mutations – DNA Intercalator Proflavin: inserts into the DNA molecule and distorts the backbone, causing base additions or deletions (and ultimately frameshift mutations) Genetic Evidence for a Triplet Code: Crick + Brenner Genetic Bacteriophage T4 rII (rapid lysis) B gene was mutated by adding proflavin during replication. Loss of function resulted in rIIB- mutants and different plaque morphologies that could be visualized (can tell difference between wild type and mutant). Wild-type Small, round borders rIIB- mutants Large plaques with Diffuse borders halos Genetic Evidence for a Triplet Code: Crick + Brenner Genetic Isolated a proflavin mutant called FC0 which could not be reverted to wild with any other type of mutagen except for proflavin • proflavin causes base insertions or deletions insertions deletions FC0 = (-) deletion of BP FC7 = (+) insertion of a BP • both together on same gene both results in restoration of wildtype Called intragenic suppression Intragenic Suppression:The restoration of gene function by one mutation canceling the other in the same gene Frameshift Mutations: changes that alter the grouping of nucleotides into codons Genetic Evidence for a Triplet Code (Crick) If a gene sustains 3 or multiples of 3 mutations of the same sign (insertions or deletions), the protein can still function as long as the mutation did not or affect the majority of amino acids Single base insertions or deletions will completely shift the reading frame and alter the protein from that point on Reading frame restored Met Asn Asn Ala Pro Glu Glu Ala Asp Met Asn Lys Arg Met Gly Glu Ala Asp Met Asn Asn Ala Pro Glu Glu Ala Asp Met Asn Asn Gly Ala Arg GlnGlu Ala Asp Gly Met Reading frame altered Met Asn Asn Ala Pro Glu Glu Ala Asp Met Asn Lys Arg Arg Arg Lys Arg Met Lys Met Asn Asn Ala Pro Glu Glu Ala Asp Met Asn AsnGly Ala Gly Gly Ser Gly Frameshift mutations : changes that alter the Frameshift grouping of nucleotides into codons DNA 5’ AUGCAUUGCCGAGUGACUUGCGUACCGUAG 3’ mRNA 5’ ATGCATTGCCGAGTGACTTGCGTACCGTAG 3’ Met His Cys Arg Val Thr Cys Val Pro Frameshift mutation - insertion AUGCAUUGCCGAAGUGACUUGCGUACCGUAG Met His Cys Arg Ser Asp Leu Arg Thr Val Frameshift mutations : changes that alter the grouping of nucleotides into codons codons Proflavin-induced frameshift mutations frameshift depend on: 1) whether the reading frame is restored 2) whether the part of the gene with an altered reading frame specifies an essential or nonessential region when translated to the protein Intragenic Suppression: + and If codons are read in order from fixed starting point, one mutation (-) will counteract another mutation (+) if the two mutations are equivalent mutations of the opposite sign mutations Cracking the code Cracking 1950s : researchers using radioactively labelled 1950s amino acids, discover that protein synthesis takes place in the cytoplasm, even though genes are located in the nucleus located Their conclusion : an intermediate molecule must Their exist that transports DNA sequence information to the cytoplasm, later shown to be mRNA the Experiments involving in vitro translation systems (cellExperiments in free extracts) • cellular extracts that contain ribosomes, tRNAs and amino acids (labeled) amino • added synthetic mRNA of known sequence to see synthetic which codons correspond to which amino acids. which Cracking the code Relies on: • cell free extracts • synthesis of artificial mRNA in vitro translation systems (cellular extracts + mRNA, will (cellular synthesize short proteins in vitro) in used with artificially synthesized used mRNAs mRNAs Couldn’t tell which codon for which amino acid nonsense mutations Cracking the code; Ribosome Binding Assay Cracking Does CUC code for Ser or Leu? • synthesize trinucleotide synthesize • label only one AA out of 20 label • attach to corresponding tRNA • add ribosomes • pour mixture through filter pour Only those tRNAs carrying the corresponding aa for the triplet will bind to the ribosome and stick to the filter, the rest will pass through Correlation of polarities in DNA, mRNA and polypeptide mRNA GENE Amino-terminus Non-template strand Carboxy-terminus Moving from 5’ to 3’ end of an mRNA, each successive codon is sequentially interpreted into an amino acid, starting with the N-terminus and ending with the C-terminus N-terminus C-terminus Nonsense codons Nonsense Three different triplets, UAA, UAG and UGA, do not Three correspond to any of the amino acids. When these codons appear in frame, translation stops, and the polypeptide chain is terminated. They are also known as stop codons. chain The genetic code is almost universal The almost Exceptions: • in some species of single-celled eukaryotic protozoans (ciliates) the codons UAA and UAG specify glutamine • differences in mitochondria i.e. those of yeast specify threonine with CUA instead of leucine 5’ in mRNA 3’ in mRNA Code consists of triplet codons-each specifies an amino acid triplet Codons are nonoverlapping Codons nonoverlapping Code includes 3 stop codons, do not code for any amino acids • nonsense codons, must be in frame with start codon nonsense Code is degenerate –more than one codon can specify each amino acid degenerate Mutations may modify the message encoded in a sequence of nucleotides in three ways. BIOL 139 Transcription Transcription Chapter 8 con’t Chapter pp 265 - 275 pp pp 331 - 344 igenetics pp ...
View Full Document

This note was uploaded on 10/04/2011 for the course BIOL 139 taught by Professor Christinedupont during the Spring '10 term at Waterloo.

Ask a homework question - tutors are online