LECTURE 15 Molecular Complexity of the Cell

LECTURE 15 Molecular Complexity of the Cell - LECTURE 15...

Info icon This preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
1 LECTURE 15 MOLECUAR COMPLEXITY OF THE CELL HIGH-THROUGHPUT TECHNIQUES HAVE ENABLED THE STUDY OF BIOLOGICAL NETWORKS AT THE MOLECULAR AND CELLULAR LEVELS Nucleotide sequencing DNA microarrays 2-dimensional gel electrophoresis and mass spectroscopy Yeast 2 hybrid analysis A LARGE PART OF BIOLOGY HAS BECOME THE STUDY OF THE VARIOUS ____ OMES Genome Transcriptome Proteome Interactome Metabolome
Image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
2 GENOME = TOTAL SUM OF THE GENETIC INFORMATION PRESENT IN THE DNA OF THE CHROMOSOMES SUMMARY OF DATA OBTAINED FROM SELECTED GENOMIC SEQUENCES ORGANISM GENOME SIZE (Mb) NUMBER OF GENES % CODING FOR PROTEIN OR RNA Bacteria (Prokaryots) 0.6 – 6.0 500 – 4,000 >90 % Yeast 12 6,000 70% Nematode worm 97 19,000 35% Mustard plant 118 26,000 35% Fruitfly 180 14,000 10% Rice 466 48,000 Zebrafish 1,700 22,000 2 % Human 3,000 23,000 1.5 % Lily 120,000 ? ? A TINY FRACTON (2500 LETTERS) OF THE SEQUENCE OF ONE HUMAN CHROMOSOME AATTCATCCAGAGCAGACACCAGGTGGGTCTGAGGAGGCCAGCATTGCCCAGTGCAAATTACACTGAACC TAGCCCTGGACAGTGCCCGAGACAAAATTCTGCCTAAATGTTCAACCCTGGCCATGCGTTAGAATCGCTG GGGGAGATTTAAACAAAATGATATCTGGGTAACCCCAGTGTTAGGGAGGCAGGAGCCTAGAAGAGACAGA GTAAGATCGTCTGAAAATCAACTCCATCCCAAAGCTAGCAAGGCATATTCCTTGCCAATCATGACCCATG GTCCTAAGATGTTTACAGCTCAGGAAGCAGCTTGGGAATGGCTTGCAAGAACAAACCCCTACAACAACAG AGAGTCCAGGTGTCCCAGTACCCGCGCTGCGCCCAGGAGAAACTGAGATAAAACGAAGCCTCGGGAAGGG
Image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}

What students are saying

  • Left Quote Icon

    As a current student on this bumpy collegiate pathway, I stumbled upon Course Hero, where I can find study resources for nearly all my courses, get online help from tutors 24/7, and even share my old projects, papers, and lecture notes with other students.

    Student Picture

    Kiran Temple University Fox School of Business ‘17, Course Hero Intern

  • Left Quote Icon

    I cannot even describe how much Course Hero helped me this summer. It’s truly become something I can always rely on and help me. In the end, I was not only able to survive summer classes, but I was able to thrive thanks to Course Hero.

    Student Picture

    Dana University of Pennsylvania ‘17, Course Hero Intern

  • Left Quote Icon

    The ability to access any university’s resources through Course Hero proved invaluable in my case. I was behind on Tulane coursework and actually used UCLA’s materials to help me move forward and get everything together on time.

    Student Picture

    Jill Tulane University ‘16, Course Hero Intern