LECTURE 15 Molecular Complexity of the Cell

LECTURE 15 Molecular Complexity of the Cell - 1 LECTURE 15...

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: 1 LECTURE 15 MOLECUAR COMPLEXITY OF THE CELL HIGH-THROUGHPUT TECHNIQUES HAVE ENABLED THE STUDY OF BIOLOGICAL NETWORKS AT THE MOLECULAR AND CELLULAR LEVELS • Nucleotide sequencing • DNA microarrays • 2-dimensional gel electrophoresis and mass spectroscopy • Yeast 2 hybrid analysis A LARGE PART OF BIOLOGY HAS BECOME THE STUDY OF THE VARIOUS l ____ OMES z • Genome • Transcriptome • Proteome • Interactome • Metabolome 2 GENOME = TOTAL SUM OF THE GENETIC INFORMATION PRESENT IN THE DNA OF THE CHROMOSOMES SUMMARY OF DATA OBTAINED FROM SELECTED GENOMIC SEQUENCES ORGANISM GENOME SIZE (Mb) NUMBER OF GENES % CODING FOR PROTEIN OR RNA Bacteria (Prokaryots) 0.6 – 6.0 500 – 4,000 >90 % Yeast 12 6,000 70% Nematode worm 97 19,000 35% Mustard plant 118 26,000 35% Fruitfly 180 14,000 10% Rice 466 48,000 Zebrafish 1,700 22,000 2 % Human 3,000 23,000 1.5 % Lily 120,000 ? ? A TINY FRACTON (2500 LETTERS) OF THE SEQUENCE OF ONE HUMAN CHROMOSOME • AATTCATCCAGAGCAGACACCAGGTGGGTCTGAGGAGGCCAGCATTGCCCAGTGCAAATTACACTGAACC • TAGCCCTGGACAGTGCCCGAGACAAAATTCTGCCTAAATGTTCAACCCTGGCCATGCGTTAGAATCGCTG • GGGGAGATTTAAACAAAATGATATCTGGGTAACCCCAGTGTTAGGGAGGCAGGAGCCTAGAAGAGACAGA • GTAAGATCGTCTGAAAATCAACTCCATCCCAAAGCTAGCAAGGCATATTCCTTGCCAATCATGACCCATG • GTCCTAAGATGTTTACAGCTCAGGAAGCAGCTTGGGAATGGCTTGCAAGAACAAACCCCTACAACAACAG • AGAGTCCAGGTGTCCCAGTACCCGCGCTGCGCCCAGGAGAAACTGAGATAAAACGAAGCCTCGGGAAGGG • AAACCCCAGACGCTCGACTTTGTGACACAAAGGCCCCAGAGGGGAGGGTGGCTTTGCCTGCTCAGCACAC • ATCATGGCTGCTGCTAAGGAGAAGGAAAAGGTTTGAGGTGTAGGGGCAGCCTGGGCCAGCTGAGTGGCAG • CTTCATTCTCCCAGCAGCTGAGTGCAAGCTGCCCACTCACTAGAGCTGTTCTCCCTTGTTTTTTTATTTT...
View Full Document

This note was uploaded on 10/11/2011 for the course CHEM 012 taught by Professor Mounaamaalouf,reneescole, during the Spring '11 term at Iowa State.

Page1 / 8

LECTURE 15 Molecular Complexity of the Cell - 1 LECTURE 15...

This preview shows document pages 1 - 3. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online