Lab #4 - Name: Karina Santana Lab Section: NET 1J...

Info iconThis preview shows pages 1–2. Sign up to view the full content.

View Full Document Right Arrow Icon
Lab Section: NET 1J Lab 4: The Genetic Code 15 points Instructions: For this lab you’ll need to start by reading pages 162-163, 167-173 and 174-178 in your text. You’ll be using information from those pages, as well as the RNA translation engine in the lab 4 folder on Blackboard to answer all the questions on this grade sheet. Do NOT use the instructions on the simulation website just use the translation engine to work through the questions. Part One: DNA to RNA (3 pts) 1. Name the 4 bases used in a DNA molecule: Thymine, Ademine, Guanine, Cytosine 2. Below is a single strand of DNA, write the complementary sequence you would expect to find on its other strand in the double helix: DNA strand: AAAGGGTACATAGCTGCGAACTCT Complement: TTTCCCATGTATCGACGCTTGAGA 3. What are the 4 bases used in an RNA molecule? Adenine , Guanine , Cytosine , Uracil 4. Take the strand of DNA below and transcribe it to an RNA strand: DNA strand: AAAGGGTACATAGCTGCGAACTCT Transcript: AAAGGGUACAUAGCUGCGAACUCU 5. RNA is read in sets of ____ 8 _____ bases called codons. 6. How many codons are in your RNA strand?
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Image of page 2
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 10/12/2011 for the course CORC 1321 taught by Professor Staff during the Fall '10 term at CUNY Brooklyn.

Page1 / 5

Lab #4 - Name: Karina Santana Lab Section: NET 1J...

This preview shows document pages 1 - 2. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online