Problem set 2

Problem set 2 - BIMM100 Problem set #2 8/10/11 ...

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: BIMM100 Problem set #2 8/10/11 Answers will not be posted online. Please consult your TAs during section for help solving these problems. For all True/False questions, if the answer is false, then write an explanation of why. If the answer is true, you do not need to write out an explanation. 1. You have a pool of cDNAs and your cDNA of interest is present at a frequency of 1 in 106. Using primers to amplify this gene, how many rounds of the polymerase chain reaction will you need to perform for your gene to be at least 99% pure? A. 4 B. 18 C. 27 D. 40 E. >50 2. During translation there are several critical steps involving the hydrolysis of GTP to GDP. What is the purpose of these hydrolysis reactions? At which steps during translation does this occur? 3. True or False: A common error that occurs during translation is the addition of an amino acid to the wrong tRNA, resulting in the incorporation of an incorrect amino acid to the growing peptide strand. 4. During DNA replication the two complementary strands are _________. These strands must be unwound by __________. The DNA must be primed by __________. 5. True or False: Topoisomerase is the enzyme responsible for ensuring the correct isomerization of DNA nucleotides during replication. 6. Explain the difference between a genomic DNA library and a cDNA library. 7. Explain why primary RNA transcripts cannot be directly translated into a protein in eukaryotic cells. What needs to happen before translation occurs? 8. You are a retrovirus at a fancy cocktail party. a. Introduce yourself to a run ­of ­the ­mill ssDNA lytic virus by listing and explaining at least 3 key differences between you and him/her. b. Oh no! While you were being assembled in the host cell earlier this morning, there was a mistake and you haven’t got your reverse transcriptase. How will this affect your life cycle? 9. You’re Marshall Nirenberg, and you’re out to solve the genetic code. Having determined that a codon is composed of 3 nucleotides, you are testing 3 ­nt RNA molecules to see which amino acids they code for. First, you want to make an extract that contains all the 20 common aminoacyl tRNAs in which all the Val tRNAs are charged with 14C ­labeled Val. a. How could you generate an extract of 14C ­Val ­charged tRNAs? Having successfully generated the above extract, you decide to incubate it with the trinucleotide polymer GUG. You filter everything through a nylon membrane, which traps large RNA molecules. Lo and behold, you see radioactivity on your filter! b. What does this mean? c. Based on these results, what is the sequence(s), written 5’ to 3’, of your Val tRNA anticodon? d. You find that no matter which amino acid is radiolabeled, you never detect radioactivity on the filter when you incubate with the trinucleotide UGA. Why? 10. Complete the following table. type of DNA what it fixes repair DNA pol proofreading when in the cell general mechanism cycle it can happen base excision repair mismatch excision repair nucleotide excision repair non ­homologous end joining homologous recombination 10. True or False: Protein synthesis is terminated with the help of a protein factor that resembles a tRNA. 11. True or False: Formation of translation initiation complexes and subsequent peptide bond formation is regulated by subunits that hydrolyze ATP. 12. True or False: DNA ligase is needed in all methods of DNA repair. 13. Compare and contrast the differences and similarities between nucleotide excision repair and transcription coupled repair. 14. What are some advantages to making a genomic versus a cDNA library? 15. Describe how you would create a genomic DNA library. How is this different from creating a cDNA library? (Explain the proteins involved and what materials are needed) 16. You generated a PCR product with Nhe1 restriction sites on both ends. Unfortunately, the vector you would like to use only has a Spe1 restriction site in it’s polylinker. Given the recognition sequences below, draw out the sticky ends that would be produced for both restriction enzymes. Label directionality and which ends have a free –OH or phosphate group. Nhe1: G|CTAGC Spe1: A|CTAGT CGATC|G TGATC|A Will you be able to ligate the PCR and vector together? Why/Why not? 17. Explain how you would go about quantitating the number of lytic bacteriophages present in a liquid sample. 18. How does the mode of replication used by retroviruses fit into the “central dogma?” What special enzyme(s) do retroviruses have that enables them to perform this process? Given the function of this enzyme, what can you speculate about the genomic material of retroviruses (like HIV)? 19. You just got hired at a pharmaceutical company that specializes in generating recombinant proteins. Your first task at your new job is to generate human insulin in E. coli cells by transforming them with a plasmid that contains insulin. When you open up the refrigerator at work, you find two tubes. One is labeled “human genomic library” and the other is labeled “human cDNA.” Which tube would you use to clone insulin from? Why? How would you actually clone the insulin gene? Note: don’t screw up ­ your boss is super mean, and loves firing UCSD undergrads! 20. What does it mean when we speak of cloning a gene “by complementation?” 21. What is PCR? What are 5 essential components needed for this assay? How is it different from DNA replication? Explain the reaction steps in PCR that occur during a successful amplification of a target sequence of DNA. 22. Given the following figures, answer the following questions to the best of your ability: BamHI NotI SmaI EcoRI Sau3A Gene X SmaI SmaI BamHI HindIII EcoRI HindIII NotI Sau3A A C promoter B a. Given the following clues, name the components of the plasmid cloning vector. The gene X is inserted (or cloned) into the A. (_________________). You need B. (______________________) for replication of the plasmid to occur. Without C. (_______________________), you will not be able to detect which cells have been transformed with the plasmid. Again, your super cranky boss comes to you, and wants you to preform some cloning. Here is your task: you must insert gene X downstream of the promoter in the plasmid shown above (it doesn’t have it’s own promoter ­ it is just a cDNA). The key sequence ACCAUGG is found inside of gene X downstream from the NotI site. You can use any combination of the restriction endonucleases present to achieve this task. But, gene X must be inserted into the same direction as it is shown (i.e. it’s directionality must not be altered) b. What enzymes will you choose for this task (use table 5 ­1 to answer this question)? Why? c. Even though you are a master of molecular biology (due to your excellent training at UCSD), you at one point considered using SmaI for this task. Why, in the end, did you decide against this? Why? If you did perform this experiment with SmaI, how could you rectify that “problem?” d. Your boss, although he is usually in a bad mood, takes pity on you, and suggests that you do not use BamHI and Sau3A for your cloning project. Why would he suggest that? 23. What is the key to performing Sanger sequencing? Be specific. 24. You wish to clone a piece of genomic DNA present in your plasmid library that spans 6kb. However, your sequencer can only generate 1kb of reliable sequence per run. How can you sequence the whole gene? 25. Compare and contrast Southern and Northern blotting. Why would you perform an in situ instead of these techniques? 26. You want to design a microarray to see what proteins are elevated in a mouse’s intestine after eating a delicious In’N Out 4x4 burger stack (it’s a really fat mouse). How would you design/perform this experiment? What material(s) would you use as a probe? SES Actin Patient C Patient B Patient A WT Patient 27. A new protein called “scrambled eggs” (SES) has been found only in the brains of people that are heavy drug users. Your labmate has received funding to perform experiments to compare the level of the gene SES in three different patients that recently died (their brains were preserved and donated to science), speculating that levels of the SES gene would be elevated in these patients. The way your colleague has decided to do this is through Northern blotting. The blot (shown below) was performed, as well as a blot for actin, a housekeeping gene present in all cells. a. What is a different assay that could be preformed to answer the same question? b. What were the probes used in these two blots? c. What are the controls your lab mate used in this experiment? d. Your lab mate determined from the above data that heavy drug users have elevated levels of SES. Do you concur? e. Your lab mate also noted that Patient B has an even higher level of SES expression, and wants to perform further experiments to investigate this. Do you think this is a good idea? Or is it just a waste of time? Why? Explain! 28. You need to analyze the following linearized 5kb DNA molecule by Southern blotting: EcoRI BamHI Probe A 2kb Probe B 1kb 5 kb You digested the DNA fragment above with EcoRI, BamHI, and a both of these enzymes together. Then, you electrophoresed these products through an agarose gel. a. You need to hybridize a probe to the DNA fragments. How do you need to process the gel and the DNA in preparation for probing? b. After performing this procedure, you incubate the DNA with probe A, which anneals to the region shown above. Below, draw how the banding pattern will appear after you expose this to X ­ray film (the probe is radioactively labeled). + denotes positive terminal of the gel, and – denotes the negative terminal of the gel. Include the sizes of the bands. EcoRI BamHI EcoRI & BamHI  ­ + c. The next day, you decide to repeat the experiment, but use a different probe (probe B). Draw the banding pattern after probing with probe B below. EcoRI BamHI EcoRI & BamHI  ­ + 29. You are working with a strain of mouse skin cells to study protein expression. a. You find that the Tm of the genomic DNA of this mouse is 40°C. This is the same Tm as the genome of the common house mouse. Can you conclude that your mouse is the same species as the common house mouse? Explain. b. You isolate mRNA from the cytoplasm of these cells. Do all the nucleotides between the 5’ untranslated region and the 3’ untranslated region in this strand code for a protein (provided there is a start codon and a downstream stop codon)? Explain your reasoning. c. You find that the sequence of the mRNA is 5’ ­ CCUAUGCUAGCUAUCUAGGCCAAAAAAAA ­3’. How many amino acids does this mRNA code for? d. You know of another four ­amino acid protein that activates skin stem cells to differentiate into mature skin cells. You want to test if this new four ­amino acid sequence from your mouse can activate skin stem cells as well. Please describe one positive and one negative control you would use in this experiment. 30. You discover that your four ­amino acid protein does, in fact, cause stem cells to differentiate into skin cells. You now want to clone this gene to make a lot of the protein. a. You want to start by creating a cDNA library. Fill in the blanks or circle the correct word describing how you would go about doing this: Isolate mRNA from cells using a column containing beads with ______________ sequences. The purpose of these sequences is to _______________. After removing the mRNA, you need to add _______________ to your solution of mRNA as well as ___________________ to create single/double ­stranded cDNA. Then, you need to remove RNA and add a ______________ to the cDNA strand in order to and hybridize this to a(n) ________________ primer. Finally, you synthesize the complementary DNA strand using _________________. You now have single ­/double ­stranded cDNA. b. Once you have the cDNA, what is the purpose of adding a linker region to both ends of the cDNA molecule? c. You determine that the best way to insert the gene into a plasmid vector is to “open up” the plasmid so that it has sticky ends. Which of the following sequences would you use a restriction enzyme against? i. 5’ ­AAGGTTCC ­3’ ii. 5’ ­CCCCTTTT ­3’ iii. 5’ ­GGCTAGCC ­3’ iv. 5’ ­GGCTTCGG ­3’ d. You expand 100 bacterial colonies. Using the sequence above (question 29c), what is the sequence of the probe you would use to determine which colonies have your gene of interest? 31. You have a side project involved with bacteria. a. The bacteria you work with create a protein that consists of 6 different peptide chains. Four of these peptides come from one mRNA, and two of these peptides are coded for from another mRNA. How many operons control the translation of this protein? b. The aforementioned protein is a toxin that the bacteria uses when infecting other organisms. If you grow the bacteria in media that contains an inhibitor of eIF4 (a protein required in formation of the initiation complex), would you decrease the toxicity of the bacteria? How do you know? c. Another option you have at your disposal to decrease the toxicity of the bacteria is to use Streptomycin, a specific inhibitor of the 30S subunit. Would the use of this drug decrease the toxicity of the bacteria? How do you know? d. Is it possible for multiple tRNA anticodons to bind to the same mRNA codon? Explain your answer. ...
View Full Document

This note was uploaded on 10/12/2011 for the course BIMM 100 taught by Professor Pasquinelli during the Summer '06 term at UCSD.

Ask a homework question - tutors are online