problem set 3

problem set 3 - have recovered a series of mutations in...

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
Biol 313 Problem set 3, Fall 2007 (14 pts) 1. (3pts) The following DNA molecule codes for a short protein of nine amino acids. a. What is the sequence of the MRNA made from this DNA? b. What is the amino acid sequence of the protein? DNA: 3’ TTAATTTACCGTTAACCGGTACTGTGGCGAAGTACTGGA 5’ 5’ AATTAAATGGCAATTGGCCATGACACCGCTTCATGACCT 3’ 2. (3pts) Three types of RNA molecules are listed below. For each briefly describe its function, and give one feature that it has that is different from the other two. a. tRNA b. mRNA c. rRNA 3 (3 pts) You have discovered two new regulatory mutations of the lac operon. Both give constitutive synthesis. Explain how you would determine whether these are operator (o) mutations or regulatory (i) gene mutations, and describe the results of your test(s) that you would expect for each possibility. 4. (5 pts) You are studying an operon in a new strain of bacteria recovered from two miles underground in South Africa. This operon has four structural genes (A, B, C, D) that produce polypeptides. You
Background image of page 1
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: have recovered a series of mutations in this operon, including two regulatory mutations (R1-, R2-) and mutations in each structural gene. In the data table below mutations with a – superscript are loss of function mutations, any gene not mentioned is +, and the phenotypes are determined by measuring whether the structural gene’s polypeptide is present (+) or absent (-). From this data: A. Draw a diagram showing the organization of this operon (the structural and control regions) in the chromosome. B. Of the four types of operon we discussed in class, which do you think this is? Strain media A B C D + (control) M-----+ (control) M+ + + + + R1-M-----R1-M+----R2-M-----R2-M+----R1-A-B-C-D + M-----R1 + A + B + C + D-R1-A-B-C-D + M+ + + + + R1 + A + B + C + D-R2-A-B-C-D + M-----R2 + A + B + C + D-R2-A-B-C-D + M+ + + +-R2 + A + B + C + D-A1-M+-+ +-B1-M+----C1-M+-+--D1- M+ + + +-...
View Full Document

This homework help was uploaded on 04/06/2008 for the course BIOL 313 taught by Professor Vollbrecht during the Fall '08 term at Iowa State.

Ask a homework question - tutors are online