problem set 3 key

problem set 3 key - Problem Set 3 1.a) 5'

Info iconThis preview shows page 1. Sign up to view the full content.

View Full Document Right Arrow Icon
Problem Set 3 1.a) 5’ AAUUAAAUGGCAAUUGGCCAUGACACCGCUUCAUGACCU 3’ b) met-ala-ile-gly-his-asp-thr-ala-ser 2. a)tRNA is the molecule that carries the anticodon and an appropriate amino acid. It interacts with mRNA via the ribosome and attaches the appropriate amino acid to the growing polypeptide. Unlike mRNA and rRNA, tRNA has an anticodon, attaches to a single amino acid, and exists in the cytoplasm. b) mRNA is the messenger molecule that is created during the transcription of DNA. Unlike DNA, mRNA does not require a primer. In eukaryotes, mRNA is edited to remove exons. Also in eukaryotes, mRNA is transferred from the nucleus into the cytoplasm to begin protein synthesis by first interacting with a ribosome. mRNA, in contrast with rRNA and tRNA, is initially synthesized in the nucleus of eukaryotes, and does not directly interact with individual amino acids. The synthesis of proteins is carried out with a tRNA intermediate. c)
Background image of page 1
This is the end of the preview. Sign up to access the rest of the document.

This homework help was uploaded on 04/06/2008 for the course BIOL 313 taught by Professor Vollbrecht during the Fall '08 term at Iowa State.

Ask a homework question - tutors are online