
Final+Fall+09 - BIS101-01 Fall 2009 Dr D J Kliebenstein...

Info iconThis preview shows pages 1–5. Sign up to view the full content.

View Full Document Right Arrow Icon
BIS101-01, Fall 2009 Dr. D. J. Kliebenstein, Instructor Final Exam Please print your name and ID number on page 2 and the rest of the exam. Do not print your ID number on the first page. The exam has 11 questions and a total of 160 points For full credit, show all of your work. AUTHORIZATION FOR PUBLIC DISTRIBUTION OF GRADED PAPERS OR EXAMINATIONS I,_________________________________, Authorize the University to publicly distribute my graded exam (e.g., handed out in class or left in an exam bin) for BIS101-01. If I do not sign, then I must see the instructor to pick up my exam. Signed:_______________________________________ Dated:__________________________________
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Name:_________________________ ID:__________________________ 1 ____ ___ 2 ____ ___ 3 ____ ___ 4 ____ ___ 5 ____ ___ 6 ____ ___ 7 ____ ___ 8 ____ ___ 9 ____ ___ 10 ____ ___ 11 ____ ___ Total ________
Background image of page 2
Name:_________________________ ID:__________________________ 1. (14 points total /2 pts each) For each phrase on the left, choose the number of the best matching term on the right. Highly mutagenic DNA Repair. Repair that occurs before replication. A to T mutations are Blue light primarily activates Repair that occurs after replication Slipped mispairing could cause an insertion in any This activity prevents mutations during replication 1. mismatch repair 2. photoreactivation repair protein 3. transitions 4. purine dimers 5. transformations 6. pyrimidine dimers 7. Photolyase 8. deamination 9. Meiosis 10. gap repair 11. 5’ to 3’ exonuclease 12. alkylating DNA 13. TTAGAAGAAGAAGAAGAACTT 14. endoreduplication repair 15. SOS repair 16. microsatellite 17. TTATCGATGCTACGTT 18. p53 protein 19. Transcription 20. Replication 21. excision repair 22. Oxidative damage 23. Transversion 24. 3’ to 5’ exonuclease
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
2. A researcher studying hoof color in reindeer found a number of mutants with white hooves. Thinking that these might be advantageous in avoiding predators in a white snowy environment the researcher went on to do a complementation analysis. The researcher was able to show that all mutant lines were true breeding and then did all of the pairwise crosses as shown below (15). Color Genotype Wildtype Black Mutant 1 White Mutant 2 White Mutant 3 White Mutant 4 White Mutant 5 White Mutant 6 White A. How many different genes were altered in the above mutants using just the information from the table (3)? B. Write in the genotypes for mutants number 1 through 5 above (6) C. Describe the relationship of all alleles at any gene you have identified (2) D. How would you have to amend your answer if you were told upon selfing the F1 individual from the M1 x M3 cross, that the F2 had a ratio of 27 Black to 37 White (4)? 4
Background image of page 4
Image of page 5
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}

Page1 / 14

Final+Fall+09 - BIS101-01 Fall 2009 Dr D J Kliebenstein...

This preview shows document pages 1 - 5. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online