Lecture 14 - DNA replication Duplication of genetic...

Info icon This preview shows pages 1–4. Sign up to view the full content.

View Full Document Right Arrow Icon
DNA replication Duplication of genetic material - Basic function of genetic material requires accurate replication - Watson and Crick noticed something in the structure: o “It has not escaped our notice that the specific pairing we have postulated immediately suggests a possible copying mechanism for the genetic material.” o Uses principle of complementarity Possible models for DNA replication: see figure 14.11 - Meselson-Stahl Experiment 1) E.coli cells grown in 15 N medium 2) Cells shifted to 14 N medium and allowed to grow 3) Samples of DNA taken at 3 time points and suspended in cesium chloride solution 4) Samples were centrifuged and the DNA migrated based on their densities 5) After 14N – light After 15N – heavier First generation – one light, one heavy strand 2 nd generation – one light, one heavy strand, a band of light Semiconservative - Semiconservative replication means that each strand is copied o Produces a new complementary strand o Conserves one “old” strand in new duplexes
Image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
- Uses the principle of complementary base pairing: depends on H-bonding patterns of bases o 5’ ATGCCGTTACGAATTCTGCTA 3’ o 3’ TACGGCAATGCTTAAGACGAT 5’ Only one strand is necessary for replication because the complementary strand can be produced so long as there is a template one. Please come home for Christmas – eagles Rudolph the red-nosed reindeer – ray charles Basic Mechanism - Open up helix - Copy each strand - Produces 2 new strands that are each hybrids of new and old strands Requirements for replication - What do we need to replicate DNA? 1. Template (an old strand); DNA to copy 2. Monomers: nucleotides 3. Enzyme: DNA polymerase 4. Open helix: helicase 5. Torsional strain: eased by topoisomerase (gyrase) a. Torsional strain occurs when it unwinds DNA polymerases (figure 14.13) - First one found in E.coli : DNA Polymerase 1 (single polypeptide chain)
Image of page 2
- Main polymerase from higher eukaryotes (large animals, humans, etc.) is more than 10 polypeptides - All DNA polymerases: o Synthesize DNA only in 5’->3’ direction (you can only add nucleotides to the 3’ end; 3’ elongation) o Require primer (for replication, usually RNA): short sequence H-bonded to template o Template/primer hybrid required for synthesis (otherwise cannot start because DNA polymerase will not begin) Priming - RNA Polymerases can initiate synthesis without a primer so priming for DNA synthesis uses an RNA polymerase (use RNA polymerase to start DNA replication) - Main enzyme used during replication: o Primase: a replication associated RNA Polymerase - Consequence: newly synthesized DNA has RNA at the start o Must remove the RNA and replace with DNA o Use 5’-> 3’ exonuclease of DNA Polymerase 1 Implications of polarity and polymerases -
Image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Image of page 4
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}

What students are saying

  • Left Quote Icon

    As a current student on this bumpy collegiate pathway, I stumbled upon Course Hero, where I can find study resources for nearly all my courses, get online help from tutors 24/7, and even share my old projects, papers, and lecture notes with other students.

    Student Picture

    Kiran Temple University Fox School of Business ‘17, Course Hero Intern

  • Left Quote Icon

    I cannot even describe how much Course Hero helped me this summer. It’s truly become something I can always rely on and help me. In the end, I was not only able to survive summer classes, but I was able to thrive thanks to Course Hero.

    Student Picture

    Dana University of Pennsylvania ‘17, Course Hero Intern

  • Left Quote Icon

    The ability to access any university’s resources through Course Hero proved invaluable in my case. I was behind on Tulane coursework and actually used UCLA’s materials to help me move forward and get everything together on time.

    Student Picture

    Jill Tulane University ‘16, Course Hero Intern