Lecture 14

Lecture 14 - DNA replication Duplication of genetic...

Info iconThis preview shows pages 1–4. Sign up to view the full content.

View Full Document Right Arrow Icon
DNA replication Duplication of genetic material - Basic function of genetic material requires accurate replication - Watson and Crick noticed something in the structure: o “It has not escaped our notice that the specific pairing we have postulated immediately suggests a possible copying mechanism for the genetic material.” o Uses principle of complementarity Possible models for DNA replication: see figure 14.11 - Meselson-Stahl Experiment 1) E.coli cells grown in 15 N medium 2) Cells shifted to 14 N medium and allowed to grow 3) Samples of DNA taken at 3 time points and suspended in cesium chloride solution 4) Samples were centrifuged and the DNA migrated based on their densities 5) After 14N – light After 15N – heavier First generation – one light, one heavy strand 2 nd generation – one light, one heavy strand, a band of light Semiconservative - Semiconservative replication means that each strand is copied o Produces a new complementary strand o Conserves one “old” strand in new duplexes
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
- Uses the principle of complementary base pairing: depends on H-bonding patterns of bases o 5’ ATGCCGTTACGAATTCTGCTA 3’ o 3’ TACGGCAATGCTTAAGACGAT 5’ Only one strand is necessary for replication because the complementary strand can be produced so long as there is a template one. Please come home for Christmas – eagles Rudolph the red-nosed reindeer – ray charles Basic Mechanism - Open up helix - Copy each strand - Produces 2 new strands that are each hybrids of new and old strands Requirements for replication - What do we need to replicate DNA? 1. Template (an old strand); DNA to copy 2. Monomers: nucleotides 3. Enzyme: DNA polymerase 4. Open helix: helicase 5. Torsional strain: eased by topoisomerase (gyrase) a. Torsional strain occurs when it unwinds DNA polymerases (figure 14.13) - First one found in E.coli : DNA Polymerase 1 (single polypeptide chain)
Background image of page 2
- Main polymerase from higher eukaryotes (large animals, humans, etc.) is more than 10 polypeptides - All DNA polymerases: o Synthesize DNA only in 5’->3’ direction (you can only add nucleotides to the 3’ end; 3’ elongation) o Require primer (for replication, usually RNA): short sequence H-bonded to template o Template/primer hybrid required for synthesis (otherwise cannot start because DNA polymerase will not begin) Priming - RNA Polymerases can initiate synthesis without a primer so priming for DNA synthesis uses an RNA polymerase (use RNA polymerase to start DNA replication) - Main enzyme used during replication: o Primase: a replication associated RNA Polymerase - Consequence: newly synthesized DNA has RNA at the start o Must remove the RNA and replace with DNA o Use 5’-> 3’ exonuclease of DNA Polymerase 1 Implications of polarity and polymerases
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Image of page 4
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 10/24/2011 for the course BIOL 110 taught by Professor Mason during the Fall '07 term at Purdue.

Page1 / 13

Lecture 14 - DNA replication Duplication of genetic...

This preview shows document pages 1 - 4. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online