BIL250 - test- 2 -07- with answer

BIL250 - test- 2 -07- with answer - BIL 250 /G Exam 2,...

Info iconThis preview shows pages 1–3. Sign up to view the full content.

View Full Document Right Arrow Icon
BIL 250 /G Exam 2, 10/01/2007 FORM 1 Name: UM ID#: I. Multiple choice format (choose the best answer from among those available. Each question is worth 4 points): Note: Correct answers are highlighted in BOLD FONT . 1. The following DNA nucleotides are found near the end of a bacterial transcription unit. 3'–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5‘ What is the RNA sequence that will be transcribed from this DNA? Will there be any secondary structures that form? a. 5'–UCGUAUGUCGUCUGGCAACCAGACUUUUUUCGUAUGU–3'; a hairpin structure can form. b. 5'–UCGUAUGUCGUCUGGCAACCAGACUUUU–3'; a hairpin structure can form. c. 5'–UGUAUGCUUUU–3'; no secondary structures will form. d. 5'– UGUAUGCUUUUUUCAGACCAACGGUCUGCUGUAUGCU–3'; no secondary structures will form. 2. Gobind Khorana et al.used chemical techniques to synthesize RNA molecules that contained known repeating sequences UGUGUGUGUGUGUGUGUG. How many types of amino acids would be found in the protein that is produced from this in vitro translation assay? a. 1 b. 2 c. 3 d. 4 e. 5 3. The number of nucleotides in the gene is proportional to the number of amino acids in the protein. a. It is true to all genes with no exceptions. b. It is only true to most genes in eukaryotic cells. c. It is only true to most genes in prokaryotic cells. d. It is never true to genes of any organisms. 4. DNA from a eukaryotic gene was isolated, denatured, and hybridized to the mRNA transcribed from the gene; the hybridized structure of two strands was then observed with the use of an electron microscope. The following structure was observed:
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Which strand is DNA? Which strand is mRNA? How many introns and exons in this gene? a. Strand I is mRNA, and there are 3 exons and 4 introns in this gene. b. Strand II is mRNA, and there are 3 exons and 4 introns in this gene. c. Strand I is DNA, and there are 4 exons and 3 introns in this gene. d. Strand II is DNA, and there are 3 exons and 4 introns in this gene. 5. Select three posttranscriptional modifications often seen in the maturation of mRNA in eukaryotes. a. 5'-capping, 3'-poly(A) tail addition, splicing b. 3'-capping, 5'-poly(A) tail addition, splicing c. removal of exons, insertion of introns, capping d. 5-poly(A) tail addition, insertion of introns, capping e. heteroduplex formation, base modification, capping 6. Initiation of transcription in eukaryotes requires following factors, except ________. a. RNA polymerase II b. transcription factors c. TATA box d. CAAT box e. sigma subunit 7. The codons AGA and AGG both encode the amino acid arginine. This illustrates their property of _________. a.
Background image of page 2
Image of page 3
This is the end of the preview. Sign up to access the rest of the document.

Page1 / 10

BIL250 - test- 2 -07- with answer - BIL 250 /G Exam 2,...

This preview shows document pages 1 - 3. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online