Extensions of Mendel's Principles Lecture 9 and 10

Extensions of Mendel's Principles Lecture 9 and 10 -...

Info iconThis preview shows pages 1–16. Sign up to view the full content.

View Full Document Right Arrow Icon
Extensions of  Extensions of  Mendel's  Mendel's  Principles Principles Chapter 5 Chapter 5
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Lucky Mendel? Lucky Mendel? 7 traits – all on different chromosomes or linkage groups all completely expressed all dominant or recessive – nothing in-between SIMPLE MENDELIAN INHERITANCE What about all the other inheritance patterns which defy  this "simple" classification?
Background image of page 2
Strawberry Poison Dart Frog Natural Genetic Variation
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
spikey Fused floral organs Purple Pigment BSCI415 Arabidopsis EMS-Induced Mutations Variegated Leaves
Background image of page 4
BSCI415 C. elegans EMS-Induced Mutations Cuticle Blister Bag-o’-worms Dumpy
Background image of page 5

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Homologous chromosomes R protein r protein …AGCTTATGGCGATTACC G TATGCTGATCTTTACGTCAT… …AGCTTATGGCGATTACC A TATGCTGATCTTTACGTCAT… R allele r allele Alleles in One Gene A G
Background image of page 6
Allele Dominance Allele Dominance Complete Recessive Wild type Heterozygote and Homozygote give  same phenotype Level of Encoded Protein AA Aa aa A= functional allele a = defective allele Threshold needed for certain trait One copy sufficient  the a allele is recessive A is dominant 2 1
Background image of page 7

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Level of Encoded Protein AA Aa aa Threshold needed for certain trait One copy sufficient  the a allele is recessive A is dominant 2 1 Complete recessive Wild type-dominant  A Mutant-recessive       a
Background image of page 8
Chloride pump pumps out salt, causing efflux of water lack of water efflux causes thick mucus Cystic Fibrosis - recessive allele of a chloride pump Wild type is dominant-one copy makes sufficient protein
Background image of page 9

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Level of Encoded Protein aa Aa AA Threshold needed for certain trait One copy is insufficient “haploinsufficiency”   2 1 Complete Dominance    Mutant -dominant       A Wild type-recessive       a MC4-R melanocortin              receptor Energy regulation Obesity  if malfunctions
Background image of page 10
Complete Dominance Wild type - recessive Mutant - dominant Secreted from cell and self assembles   to make microbril network for     connective tissue & cell adhesion Mutations (colors)  fail to assemble and prevents normal protein in heterozygote from assembling Marfan syndrome Fibrillin encoded by FBN1 http://www.stcatz.ox.ac.uk/subject_pages/biochemistry_2.htm http://www.youtube.com/watch?v=U
Background image of page 11

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Achondroplasia Fibroblast growth factor receptor gene 3 (FGFR3) – inhibits bone       growth early in development Failure of the mutant receptor to turn off in development inhibits         bone growth Dominant since mutated protein is stuck on       while wild type gene turns on then off Wt aa Mutant Aa FGFR3 signaling
Background image of page 12
Incomplete Dominance
Background image of page 13

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Incomplete Dominance Heterozygote and Homozygote give different  phenotype - heterozygote is intermediate Level of Encoded Protein AA Aa aa A= functional allele a = defective allele Continuous trait  No Threshold needed  e.g. amount of pigment 2 1 Red Pink White
Background image of page 14
3.9 p.59 symbolism????
Background image of page 15

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Image of page 16
This is the end of the preview. Sign up to access the rest of the document.

This document was uploaded on 11/04/2011 for the course BSCI 222 at Maryland.

Page1 / 63

Extensions of Mendel's Principles Lecture 9 and 10 -...

This preview shows document pages 1 - 16. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online