Gene expression lecture 16, 17 and 18

Gene expression lecture 16, 17 and 18 - 10.16 p.280 Gene...

Info iconThis preview shows pages 1–7. Sign up to view the full content.

View Full Document Right Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: 10.16 p.280 Gene Expression: Gene Expression: Transcription Transcription RNA Processing Translation RNA Processing Translation Chapters 13, 14 and 15 Chapters 13, 14 and 15 M K L FW LL FT I GF C WAQYSSNTQQG R TS IV H L F E W R W V D I A L E C E R Y L AP K G FGG V Q V SPPN E N V A I HNPF R PWW E R YQP V SY K L C T R SGN EDE F R NM V T R C NN V G V R I Y V D A VI NHM C GNA V SAGTSST C GSYFNPGS R D FPA V PYSGW D FN D G K C K TGSG D I E NYN D ATQ V R D C R L SG LL D L A L G K D Y V R S K I A E YMNH LI D I G V AGF R I D AS K HMWPG D I K A IL D K L HN L NSNWFP E GS K PF I YQ E VI D L GG E P I K SS D YFGNG R V T E F K YGA K L GT VI RK WNG E K MSY L K NWG E GWGFMPS D R A LV F V D NH D NQ R GHGAGGAS IL TFW D A R L Y K MA V GFM L AHPYGFT R V MSS Y R WP R YF E NG K D V N D W V GPPN D NG V T K E V T I NP D TT C GN D W V C E H R W R Q I R NM V NF R N VV D GQPFTNWY D NGSNQ V AFG R GN R GF IV FNN DD WTFS L T L Q TG L PAGTY C D VI SG D K I NGN C TG I K I Y V S DD G K AHFS I SNSA ED PF I A I HA E S K L Blue + charge Red - charge Green hydrophobic Yellow sulfur Amylase Converts starch to glucose Amino acid sequence Amylase Gene AMY1- DNA sequence Chromosome 1 p21 ATGAAGCTCTTTTGGTTGCTTTTCACCATTGGGTTCTGCTGGGCTCAGTATTCCTCAAATACACA ACAAGGACGAACATCTATTGTTCATCTGTTTGAATGGCGATGGGTTGATATTGCTCTTGAATGT GAGCGATATTTAGCTCCCAAGGGATTTGGAGGGGTTCAG GTCTCTCCACCAAATGAAAATGTT GCCATTCACAACCCTTTCAGACCTTGGTGGGAAAGATACCAACCAGTTAGCTATAAATTATGCA CAAGATCTGGAAATGAAGATGAATTTAGAAACATGGTGACTAGATGCAACAATGTTGGG GTTCG TATTTATGTGGATGCTGTAATTAATCATATGTGTGGTAATGCTGTGAGTGCAGGAACAAGCAGT ACCTGTGGAAGTTACTTCAACCCTGGAAGTAGGGACTTTCCAGCAGTCCCATATTCTGGATGG GATTTTAATGATGGTAAATGTAAAACTGGAAGTGGAGATATCGAGAACTATAATGATGCTACTC AG GTCAGAGATTGTCGTCTGTCTGGTCTTCTCGATCTTGCACTGGGGAAGGATTATGTGCGTT CTAAGATTGCCGAATATATGAACCATCTCATTGACATTGGTGTTGCAGGGTTCAGAATTGATGC TTCCAAGCACATGTGGCCTGGAGACATAAAGGCAATTTTGGACAAACTGCATAATCTAAACAGT AACTGGTTCCCGGAAGGTAGTAAACCTTTCATTTACCAGGAG GTAATTGATCTGGGTGGTGAG CCAATTAAAAGCAGTGACTACTTTGGTAATGGCCGGGTGACAGAATTCAAGTATGGTGCAAAAC TCGGCACAGTTATTCGCAAGTGGAATGGAGAGAAGATGTCTTACTTAAA GAACTGGGGAGAAG GTTGGGGTTTCATGCCTTCTGACAGAGCGCTTGTCTTTGTGGATAACCATGACAATCAACGAG GACATGGCGCTGGAGGAGCCTCTATACTTACCTTCTGGGATGCTAGGCTGTACAAAATGGCAG TTGGATTTATGCTTGCTCATCCTTATGGATTTACACGAGTAATGTCAAGCTACCGTTGGCCAAG ATATTTTGAAAATGGAAAA GATGTTAATGATTGGGTTGGGCCACCAAATGATAATGGAGTAACT AAAGAAGTTACTATTAATCCAGACACTACTTGTGGCAATGACTGGGTCTGTGAACATCGATGGC GCCAAATAAG GAACATGGTTAATTTCCGCAATGTAGTGGATGGCCAGCCTTTTACAAACTGGTA TGATAATGGGAGCAACCAAGTGGCTTTTGGGAGAGGAAACAGAGGATTCATTGTTTTCAACAAT Transcription Transcription Polymerization of ribonucleotides guided by complementary base pairing produces an RNA transcript from a DNA template 13.4 p.349 Gene Expression Overview Gene Expression Overview DNA RNA protein Crick's "Central Dogma BUT - not all genes encode proteins not all gene transcripts are RNA that are translated many types of RNA made Types of RNA Types of RNA p.348 Transcription...
View Full Document

Page1 / 105

Gene expression lecture 16, 17 and 18 - 10.16 p.280 Gene...

This preview shows document pages 1 - 7. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online