Genetic Engineering

Genetic Engineering - Genetic Genetic Engineering...

Info iconThis preview shows pages 1–17. Sign up to view the full content.

View Full Document Right Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
This is the end of the preview. Sign up to access the rest of the document.

Unformatted text preview: Genetic Genetic Engineering Engineering Chapter 19 Chapter 19 Manipulations of genes Manipulations of genes Isolate the DNA/gene of interest from a genome Produce multiple copies for biochemical studies Determine the DNA sequence of gene Express gene in another organism Knock out gene in original organism Vary the sequence of the gene and reintroduce into original organism 11.4 p.289 One molecule of DNA Tools of Manipulation Tools of Manipulation Enzymes restriction enzymes-cut DNA Ligase- pastes together DNA Gel Electrophoresis separates DNA by size Vectors for replicating a specific DNA in vivo PCR amplification of DNA in vitro DNA Sequencing Restriction Enzymes Restriction Enzymes Cut DNA at a specific sequence vary in what sequence they recognize & cut First isolated from bacteria Generally recognize palindromic sequences 5 GAATTC 3 3 CTTAAG 5 Over 3000 have been isolated 800+ 5AATTAGGATAT G 3'TTAATCCTATA CTTAA AATTC TTGAATAGCGCGA 3' G AACTTATCGCGCT 5' Type II Restriction Enzyme EcoRI 5 5 T19.1 DNA Ligase Reseals ends anneal different DNAs with same overlap 19.2 p.507 HindIII Cuts at every GAATTC AGAGGC AAGCTT GCTCGATGC AAGCTT TATGCGGGACGCTACCGAGGCA AAGCTT TATCGGTATGCT GTTAGGCGGCTGCGCTATGTATGTCGTACCCGTCGGTTATGC AAGCTT GTAGTGGGCTATATATTAG Agarose Gel Electrophoresis Agarose Gel Electrophoresis carrying with electricity Agarose is a polysaccharide Application of current DNA is negatively charged Moves toward positive electrode Rate of migration is inversely proportional to the log10 of MW Visualizing DNA Visualizing DNA Ethidium bromide (EtBr) Intercalates in DNA Excite with UV light and it emits light in the visible range ** mutagenic ** Can detect as little as 1 - 5 ng of DNA Stain intensity is proportional to amount of DNA present. Detection of Specific DNA bands with labeled probes Probe DNA is a known sequence- looking for similar sequence - labeled with 32 P or fluorescent label http://www.slic2.wsu.edu:82/hurlbert/micro101/pages/Chap10.html HindIII Cuts at every GAATTC AGAGGC GAATTC GCTCGATGC GAATTC TATGCGGGACGCTACCGAGGCA GAATTC TATCGGTATGCT GTTAGGCGGCTGCGCTATGTATGTCGTACCCGTCGGTTATGC GAATTC GTAGTGGGCTATATATTAG ????? GAATTC ????????? GAATTC ?????????????????????? GAATTC ???????????? ????????????????????????????????????????? GAATTC ???????????????????...
View Full Document

Page1 / 87

Genetic Engineering - Genetic Genetic Engineering...

This preview shows document pages 1 - 17. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online