mutation and repair lecture 23

mutation and repair lecture 23 - Drosophila Mutants...

Info iconThis preview shows pages 1–21. Sign up to view the full content.

View Full Document Right Arrow Icon
Drosophila Mutants Drosophila ~14,000 genes
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Mouse Mutants ~23,000 genes
Background image of page 2
Gene Mutations and DNA Repair Chapter 18 GCTTTACCTATAGGATGCCGTCTCTAGGAAGCTAATATGGCGC GCTTTACCTATA C GATGCCGTCTCTAGGAAGCTAATATGGCGC GCTTTACCTATAGGATGCCGTC C CTAGGAAGCTAATATGGCGC GCTTTACCTATAGGATGCCGTCTCTAGGAAGCT G ATATGGCGC GCTTTACCTATAGGATGCCGTCTGG AAGCTAATATGGCGCC GCTTTACCT CCGCCG ATAGGATGCCGTCTCTAGGAAGCTAATA GCTTTACCTATAGGATGC T GTCTCTAGGAAGCTAATATGGCGC
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Mutations: source of loss of information source of genetic variation Mutations are changes in DNA Small change in DNA sequence Chromosomal rearrangements (next topic) Heritability is Cell - Dependent Somatic mutations Germ-line mutations
Background image of page 4
18.1 p.473 Somatic vs germ-line mutations Animals set aside germ line early
Background image of page 5

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Somatic vs germ-line mutations Animals set aside germ line early Plants do not
Background image of page 6
Types of Mutations Effect on DNA molecule Substitution A base is replaced by one of the other three bases transitions and transversions 18.2 p.473
Background image of page 7

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
A G T C purines pyrimidines Transitions
Background image of page 8
A G T C purines pyrimidines Transversions
Background image of page 9

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Assume that a wild-type sequence is 5’ AGCCTAC 3'. Indicate the sequence that might be produced by a transversion. 1. 5’ AGTCTAC 3’ 2. 5’ AGCCGCCGCCGCCTAC 3’ 3. 5’ AGCCCAC 3’ 4. 5’ ATCCTAC 3’ 5. 5’ AGCCTGC 3’
Background image of page 10
Silent mutation Alteration of nucleotide does not alter amino acid “synonymous” (versus “nonsynonymous) 18.6 p.476 Effect of substitutions on protein
Background image of page 11

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
The Genetic Code 15.10 p.404
Background image of page 12
Missense different amino acid substituted “Nonsynonymous” mutation 18.6 p.476 Effect of substitutions on protein
Background image of page 13

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Nonsense premature stop codon inserted 18.6 p.476 Effect of substitutions on protein
Background image of page 14
Types of Mutations Insertion or Deletion of bases 18.2 p.473
Background image of page 15

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Effect of Insertion or deletion on protein: Frameshift mutation changes triplet reading frame 18.2 p.473 gly ser val asp arg gly ser val arg ser gly ser glu thr val gly ser ala asp arg Frameshift
Background image of page 16
AAAATGAAGCTCTTTTGGTTGCTTTTCACCATTGGGTTC TGCTGGGCTCAGTATTCCTCAAATACACAACAAGGACGA ACATCTATTGTTCATCTGTTTGAATGGCGATGGGTTGAT ATTGCTCTTGAATGTGAGCGATATTTAGCTCCCAAGGGA N E A L L V A F H H W V RF3 L L G S V F L K Y T T R T N I Y C S S V stop M A M G stop Y C S stop M stop A I F S S Q G K stop S S F G C F S P L G S RF2 H L L F I C L N G D G L I L L L N V S D I stop L P R A G L S I P Q I H N K D E C W A Q Y S S N T Q Q G R S I V H L F E W R W V D I A L E C E R Y L A P K G F M K L F W L L F T I G F RF1 Amylase Gene- DNA sequence coding strand
Background image of page 17

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
AAAATGAAGCTCTTTTGGTTGCTTTTC CATTGGGTTC TGCTGGGCTCAGTATTCCTCAAATACACAACAAGGACGA ACATCTATTGTTCATCTGTTTGAATGGCGATGGGTTGAT ATTGCTCTTGAATGTGAGCGATATTTAGCTCCCAAGGGA H W V L L G S V F L K Y T T R T N I Y C S S V stop M A M G stop Y C S stop M stop A I F S S Q G M K L F W L L F RF1 Amylase Gene- DNA sequence coding strand AC RF3
Background image of page 18
“mutations” Polymorphisms SNPs BRCA1 gene Breast Cancer Susceptibility DNA Repair
Background image of page 19

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full Document Right Arrow Icon
Range of mutations- Single Nucleotide Polymorphisms (SNPs) in BRCA1 gene
Background image of page 20
Image of page 21
This is the end of the preview. Sign up to access the rest of the document.

{[ snackBarMessage ]}

Page1 / 63

mutation and repair lecture 23 - Drosophila Mutants...

This preview shows document pages 1 - 21. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online