BYS201_Genomics - BYS201Genomics

Info iconThis preview shows pages 1–8. Sign up to view the full content.

View Full Document Right Arrow Icon
BYS201 Genomics Genome:   Collection of DNA molecules that carries the  hereditary information of an organism. Genomics : Study of the sequence, content and history of  genome. History of the genome:
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Tree of Life Based on sequence similarities - Evolutionary trees Previously morphological data and fossil data used Now Gene sequences are used 16sRNA common to all organisms Why rRNA? Machinery translates gene to proteins 1 st emerging macromolecules
Background image of page 2
Sequence similarity and Homologous Genes: Mutations:  Changes in the sequence Point mutations and alterations (single nucleotide) 3’…ATGGGCTGCACGGAT…5’ 3’…ATGGGCTG T ACGGAT…5’ Homologous gene sequences are derived from a common ancestor GTAATCG (ancestor sequence) GTCATCG (GT T ATCG) (GT G ATCG) GTAATCG GT C ATCG GTAATCG (GTA G TCG) (GTA T TCG) GTACTCG
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Global alignment: GTAATCG GTAATCG GTACG__ GTA__CG Local alignment: GTCTACGGTAATCG AGGTCATCGGTGGTCGGTGTCGGTAAG Local alignment provides information about sequence motifs GTAATCG GTAATCG GTAATCG GTACG_ _ _ _GTACG    _GTACG_ (If Gap= -6; substitution = -5; matching sequence= 3) Similarity score S= -13, -27 and –29 Sequence similarity is checked using
Background image of page 4
Commonly used scoring formula is: add 1 for each  matching  letter; subtract 1 for each mismatch; subtract 5 for each gap opening;  subtract 1 for each gap in alignment. GTAACTGCTGCTAGA__ GTAC_ _GC_ _GTCG S= 6(1) + 3(-1) + 3(-5) + 6(-1) = -18 Probability of finding a small simple sequence versus finding a  longer sequence for homology (ACGT vs GTCATCTACGT) r
Background image of page 5

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
However, in protein sequence matches certain amino acid  replacements carry less penalty due to the fact that these  substitutions may not result in any significant change in protein  function (G, A); (A, S): (S,T): (I,V,L). 
Background image of page 6
Ortholog and Paralog Genes: Paralog  Genes:  Genes that appear as more than one copy in an  organism and arise by duplication.   Paralog  genes differ slightly in sequence from each other  Products of  paralog  genes may diverge in their function during the  course of evolution. Orthologous
Background image of page 7

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Image of page 8
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 11/07/2011 for the course BYS 201 taught by Professor Podila during the Spring '09 term at University of Alabama - Huntsville.

Page1 / 34

BYS201_Genomics - BYS201Genomics

This preview shows document pages 1 - 8. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online