Genomics_SG - BYS201Genomics

Info iconThis preview shows pages 1–5. Sign up to view the full content.

View Full Document Right Arrow Icon
BYS201 Genomics Genome:   Collection of DNA molecules that carries the hereditary  information of an organism. Genomics : Study of the sequence, content and history of genome. History of the genome: Sequence similarity and Homologous Genes: Mutations:  Changes in the sequence Point mutations and alterations 1
Background image of page 1

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Global alignment: GTAATCG GTAATCG GTACG__ GTA__CG Local alignment: GTCTACGGTAATCG AGGTCATCGGTGGTCGGTGTCG GTAAG Local alignment provides information about sequence motifs GTAATCG GTAATCG GTAATCG GTACG__ __GTACG _GTACG_ (If Gap= -6; substitution = -5; matching sequence= 3) Similarity score S= -13, -27 and –29   Commonly used scoring formula is: add 1 for each  matching letter;  subtract 1 for each mismatch; subtract 5 for each gap opening; subtract 1 for  each gap in alignment. GTAACTGCTGCTAGA__ GTAC_ _GC_ _GTCG Probability of finding a small simple sequence versus finding a longer  sequence for homology (ACGT vs GTCATCTACGT) P(b) = 1(-4 r ) 2
Background image of page 2
Eykaryotes: E(b) = (m-r)/(4 r The number of hits decrease as the sequence length increases. However, in protein sequence matches certain amino acid replacements  carry less penalty due to the fact that these substitutions may not result in  any significant change in protein function (G, A); (A, S): (S,T): (I,V,L).  3
Background image of page 3

Info iconThis preview has intentionally blurred sections. Sign up to view the full version.

View Full DocumentRight Arrow Icon
Ortholog and Paralog Genes: Paralog  Genes:  Genes that appear as more than one copy in an organism  and arise by duplication.   Paralog  genes differ slightly in sequence from each other  Products of  paralog  genes may diverge in their function during the course of  evolution. Orthologous  genes: Genes in different species that arose from common  ancestor during speciation. Orthologous  genes perform similar functions. How does one establish whether two genes are orthologs or paralogs? Genes compared between genomes for 
Background image of page 4
Image of page 5
This is the end of the preview. Sign up to access the rest of the document.

This note was uploaded on 11/07/2011 for the course BYS 201 taught by Professor Podila during the Spring '09 term at University of Alabama - Huntsville.

Page1 / 14

Genomics_SG - BYS201Genomics

This preview shows document pages 1 - 5. Sign up to view the full document.

View Full Document Right Arrow Icon
Ask a homework question - tutors are online